NLP SNP

Report for SNP rs6265

Developed by Shray Alag, 2020.

SNP Clinical Trial Gene

There are 9 clinical trials

Clinical Trials

1 Epigenetic Regulation of Brain-Derived Neurotropic Factor (BDNF) in Patients With Major Depression

The investigators will (1) detect the associations between brain-derived neurotrophic factor (BDNF) DNA methylation, histone modification, depressive symptoms, suicidal behavior and antidepressant responses in major depressive disorder (MDD) patients, (2) check the correlation between blood BDNF protein and RNA and BDNF rs6265 gene, and (3) discuss the possible mechanisms of epigenetic regulation of BDNF in Taiwanese major depressive patients.

NCT01182103 Major Depressive Disorder

MeSH:Depression Depressive Disorder Depressive Disorder, Major

HPO:Depressivity

Epigenetic Regulation of BDNF in Major Depression The investigators will (1) detect the associations between brain-derived neurotrophic factor (BDNF) DNA methylation, histone modification, depressive symptoms, suicidal behavior and antidepressant responses in major depressive disorder (MDD) patients, (2) check the correlation between blood BDNF protein and RNA and BDNF rs6265 gene, and (3) discuss the possible mechanisms of epigenetic regulation of BDNF in Taiwanese major depressive patients.

Primary Outcomes

Description: averaged percentage of methylation at each CpG site listed

Measure: Brain-derived Neurotrophic Factor (BDNF) DNA Methylation of Major Depressive Disorder (MDD) Patients and Healthy Controls

Time: 2 years

Description: Chromatin immunoprecipitation (ChIP) was used to measure histone modification. The unit of our given machine is relative quantification, and a higher value indicated increased histone modification. The detailed method could be found in: Huebert DJ, Kamal M, O'Donovan A, Bernstein BE: Genome-wide analysis of histone modifications by ChIP-on-chip. Methods 2006; 40: 365-369.

Measure: Histone Modification of MDD Patients Before and After Treatment and With Healthy Controls

Time: 2 years

Secondary Outcomes

Description: Serum BDNF levels were measured. MDD patients received antidepressant treatment, a standard biological management. Nothing novel (such as experimental drugs or management) is introduced in the treatment, so the research design is observational (of standard treatment). The choice of antidepressant drugs depended on the need of patients in natural treatment procedure. They included selective serotonin reuptake inhibitors (SSRI), eg. fluoxetine or paroxetine.

Measure: BDNF Levels of MDD Patients Before and After Treatment and Healthy Controls

Time: 2 years

2 The Influence of 5-HTTLPR and BDNF Polymorphisms on Anxiety and Mood After Acute Exercise

The Influence of 5-HTTLPR and BDNF Polymorphisms on Anxiety and Mood After Acute Exercise. Introduction: The 5-HTTLPR (SLC6A4) and BDNF (Val66Met) polymorphism presents an action on the modulation of human behavior and has received great attention as a risk factor for several psychiatric disorders. In recent years, a growing number of studies have evaluated the association between these polymorphisms and personality traits related to anxiety and depression. Objectives: To determine the frequencies of 5-HTTLPR and BDNF polymorphisms in a college students population; To determine the influence of 5-HTTLPR and BDNF polymorphisms on mood states and anxiety after acute physical exercise. Material and Methods: Four hundred (400) College students will be assessed. In the first phase of the study, the following procedures will be performed: Screening, Aerobic Fitness Assessment (Step Test), Questionnaires (PAR-Q, Habitual Physical Activity Level, Beck Anxiety and Depression Scale, State-Trait Anxiety, and Perceived Stress Scale), blood sample collection and genotyping. In the second phase of the study, two (2) groups with or without polymorphisms will be selected (for each gene). These groups will be submitted to four conditions (three experimental conditions and one control condition), carried out randomly and separated by an interval of 1 week. In the experimental Conditions the volunteers will perform treadmill exercises sessions (30 minutes) in three different intensities (light, moderate and vigorous) and will respond to the Borg Scale at 10, 20 e 30 minutes. In the control condition the volunteers will be instructed to remain seated (quiet rest), relaxed and silent for 30 minutes. In both conditions, the volunteers will complete the Profile of Mood States (POMS) and State-Anxiety (STAY), 05 (five) minutes before and, 5 (five) and 20 (twenty) minutes following the interventions.

NCT03556176 Polymorphisms Exercise Mood Behavioral: Exercise Behavioral: Quiet rest

MeSH:Anxiety Disorders

PCR will be performed with the following primers forward (GGCGTTGCCGCTCTGAATGC) and reverse (GAGGGACTGAGCTGGACAACCAC).. Detection of the polymorphism BDNF Val66Met SNP rs6265 genotype (G196A).

The BDNF Val66Met SNP rs6265 genotype (G196A) will be obtained, using a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method with forward (5'-ACTCTGGAGAGCGTGAAT-3') and reverse (5'-ATACTGTCACAC ACGCTC-3') primers, and further digestion of the PCR product with NlaIII enzyme (Cat.

Primary Outcomes

Description: The POMS questionnaire is an instrument to evaluate mood states. It has 65 items and 6 domains: tension-anxiety, depression, anger-hostility, vigour-activity, fatigue, and confusion- bewilderment. The total mood disturbance score is derived by subtracting the vigour-activity score from the the sum of scores from the other subscales. The iceberg profile is characterized by low raw scores on the tension, depression, anger, fatigue, and confusion scales and above norms (the "water line") on vigor.

Measure: Response of mood states after interventions

Time: Change from 5 minutes before the treatments to 5 and 20 minutes after three exercise intensities and quiet rest

Description: Anxiety Inventory-STAI trait-state. The scales encompasses 20 items and provides a one-dimensional measurement of anxiety. Range of scores for each subtest is 20-80, the higher score indicating greater anxiety. A cut point of 39-40 has been suggested to detect clinically significant symptoms.

Measure: Response of anxiety after interventions

Time: Change from 5 minutes before the treatments to 5 and 20 minutes after three exercise intensities and quiet rest

Secondary Outcomes

Description: The Physical Activity Readiness Questionnaire (PAR-Q) was originally designed as a screening questionnaire to be self-administered before beginning physical activity. It has been designed to identify the small number of adults for whom physical activity may be inappropriate or those who should have medical advice concerning the type of activity most suitable for them.The people who to answer yes to one or more of seven questions will be advised to consult their doctors before increasing their physical activity. Those who to answer no to all questions will be included in the protocol study.

Measure: Evaluation safety or possible risk of exercising

Time: baseline

Description: Habitual Physical Activity Level (BAECKE):The Baecke Questionnaire was developed to measure habitual physical activity. The questionnaire includes items about household activities, sport, and leisure time activities over the past year. The Sport Index is divided into four categories (<1 h; 1-2 hrs; 2-3 hrs; 3-4 hrs and > 4 hrs) and each of these categories has an appropriate coefficient (0.5; 1.5; 2.5; 3.5 and 4.5) Usual daily activity and leisure activity are scored in a range of from 0 to 5. Global PA will be the sum of 3 indexes.

Measure: Habitual Physical Activity Level

Time: Baseline

Description: Beck Inventory Anxiety and Depression: The Beck Depression and Anxiety Inventory consists of a self-report questionnaires. These instruments are used to measure the severity of depressive and anxiety episodes.These instruments are widely used by health professionals and researchers in a variety of clinical and research settings. In the Beck Depression Inventory normal score are between 0 and 15; medium depression scores from 15 to 20 (dysphoria), and high depression scores over 20, and in the Beck Anxiety Inventory: 0-9: normal to minimal anxiety;10-18: mild to moderate anxiety;19-29: moderate to severe anxiety and 30-63: severe anxiety.

Measure: Evaluation of depression and anxiety symptoms

Time: Baseline

Description: McArdle Step Test was developed to estimate the aerobic capacity of university students. For the test the individual must ascend and descend a step during 3 min with different stepping rates for women and men (22 and 24 steps/min, respective

Measure: Estimation the aerobic capacity

Time: Baseline

Description: The detection of the polymorphism in the SLC6A4 gene will be done by the PCR-RFLP method: restriction fragment length polymorphism (RFLP), in which the PCR amplification of the flanking region of the SNP is followed by the digestion reaction with a specific restriction enzyme. The polymorphism of the SLC6A4 gene will be determined by the Polymerase Chain Reaction (PCR) and subsequent gel electrophoresis. PCR will be performed with the following primers forward (GGCGTTGCCGCTCTGAATGC) and reverse (GAGGGACTGAGCTGGACAACCAC).

Measure: Detection of the polymorphism in the SLC6A4

Time: Baseline

Description: The BDNF Val66Met SNP rs6265 genotype (G196A) will be obtained, using a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method with forward (5'-ACTCTGGAGAGCGTGAAT-3') and reverse (5'-ATACTGTCACAC ACGCTC-3') primers, and further digestion of the PCR product with NlaIII enzyme (Cat. No. R0125S, New England Biolabs). From the five possible restriction fragments for this Val66Met amplicon, the genotype will be identified by the size and distribution of three bands: 243 bp for the G variant (Val), 168 bp and 75 bp bands for the A variant (Met), and these three bands for GA heterozygotes (Val/Met), on 2.5% (w/v) agarose gel electrophoresis.

Measure: Detection of the polymorphism BDNF Val66Met SNP rs6265 genotype (G196A)

Time: Baseline

3 Efficacy of Transcranial Direct Current Stimulation for Severe Refractory Primary Dysmenorrhea: Translational and Genetic Neuroimaging Studies

Primary Dysmenorrhea (PDM), defined as menstrual pain without discernable organic causes, is inexorably common in adolescent women, about 40-90% of women may suffer from it, and 20% of them can be severe in the context of being refractory to medication, daily function impairment, and having pain of severe degree. Novel therapeutic method is in need for pain alleviation for this particular phenotype. We have previously reported that PDM females may engage motor-cortex based descending pain modulation system in our resting-state functional Magnetic Resonance Imaging (rs-fMRI) and thermal pain-activation fMRI studies. Based on the reported analgesic efficacy of transcranial Direct Current Stimulation (tDCS) on the motor cortex for various experimental painful conditions and clinical pain disorders, we reason that tDCS can be effective for the severe and medication-refractory PDM patients. This study aim to investigate the analgesic efficacy of tDCS in severe PDMs and to elucidate the dynamic brain neuroplasticity in the context of functional connectivity (FC) of pain matrix after tDCS intervention. We will recruit 30 severe PDMs and randomly allocate them to either real or sham group in a triple-blind manner. rs-fMRI for functional connectivity analysis will be performed before and after the tDCS intervention. The imaging data will be correlated with behavioral and psychological measurements. This is the first study in the literature investigating the tDCS efficacy for severe PDM. The result can promise a new possibility for clinical application.

NCT03594916 Primary Dysmenorrhea Device: Active tDCS Device: Sham tDCS

MeSH:Dysmenorrhea

HPO:Dysmenorrhea

To genotype the single nucleotide polymorphism genotyping (i.e., BDNF Val66Met polymorphism (rs6265), COMT Val158Met polymorphism (rs4680), OPRM1 (rs1799971), 5HTR2A (rs6313), SLC6A4 (rs25531)) from blood specimen.

Primary Outcomes

Description: pain scale; from 0 to 10; score 0: no pain, score 10: unbearable pain

Measure: Visual Analog Scale (VAS)

Time: change from baseline (1st menstrual phase, before tDCS) at one month (2nd menstrual phase, with tDCS), change from baseline (1st menstrual phase, before tDCS) at two months (3rd menstrual phase)

Description: Resting-state functional magnetic resonance imaging (rs-fMRI) is a well established method of functional magnetic resonance imaging (fMRI) that is used to evaluate regional interactions in the brain that occur in a resting (task-negative) state, when a subject is not performing an explicit task. Functional connectivity is the connectivity between brain regions that share functional properties, it can be defined as the correlation between spatially remote neurophysiological events, expressed as the neural networks of brain.

Measure: Functional connectivity of rs-fMRI Imaging

Time: change from baseline (before tDCS, before 2nd menstrual phase) at one week (after tDCS completion), change from baseline (before tDCS, before 2nd menstrual phase) at four weeks (before the 3rd menstrual phase)

Secondary Outcomes

Description: To assess the threshold of thermal sensation (cold, cold-pain, heat, heat-pain; from 0 to 50 centigrade temperature), according to the established protocol of an ascending limit approach for heat pain and a descending limit approach for cold pain.

Measure: Quantitative sensory testing (QST)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

Description: To assess anxious symptoms; from 20 to 80; score 20: not anxious, score 80: extremely anxious

Measure: Spielberger State-Trait Anxiety Inventory (STAI)

Description: To assess anxious symptoms; from 0 to 63; score 0: not anxious, score 63: extremely anxious

Measure: Beck Anxiety Inventory (BAI)

Description: To assess depressive symptoms; from 0 to 63; score 0: not depressed, score 63: extremely depressed

Measure: Beck Depression Inventory (BDI)

Description: To assess pain-maladaptive psychological status; from 0 to 52; score 0: not pain Catastrophizing , score 52: extremely pain Catastrophizing

Measure: Pain Catastrophizing Scale (PCS)

Description: To assess pain status; from 0 to 78; score 0: not painful, score 78: extremely painful

Measure: Long-form McGill Pain Questionnaire (MPQ)

Description: To assess quality of life; he SF-36 consists of eight scaled scores, which are the weighted sums of the questions in their section. Each scale is directly transformed into a 0-100 scale on the assumption that each question carries equal weight. From 0 to 100; score 0: equivalent to maximum disability, score 100: no disability.

Measure: Short-Form Health Survey (SF-36)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

Description: To assess testosterone, progesterone, estrogen

Measure: Blood Hormones Measurement

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase)

Description: To genotype the single nucleotide polymorphism genotyping (i.e., BDNF Val66Met polymorphism (rs6265), COMT Val158Met polymorphism (rs4680), OPRM1 (rs1799971), 5HTR2A (rs6313), SLC6A4 (rs25531)) from blood specimen

Measure: Genotyping

Time: baseline

Description: To assure blinding efficacy; Patients do self-assessment about whether they receive real tDCS or sham tDCS. Assessment questionnaire:1 or 0. 1: real tDCS; 0: sham tDCS.

Measure: Efficacy of tDCS blinding

Time: At 1 months after tDCS intervention

4 Neuromodulation Effect of Transcranial Direct Current Stimulation in Severe Refractory Primary Dysmenorrhea: BDNF and MEG Study

Primary Dysmenorrhea (PDM), defined as menstrual pain without discernable organic causes, is inexorably common in adolescent women, about 40-90% of women may suffer from it, and 20% of them can be severe in the context of being refractory to medication, daily function impairment, and having pain of severe degree. Novel therapeutic method is in need for pain alleviation for this particular phenotype. It has been reported that PDM females may engage motor-cortex based descending pain modulation system in our resting-state functional Magnetic Resonance Imaging (rs-fMRI) and thermal pain-activation fMRI studies. Based on the reported analgesic efficacy of transcranial Direct Current Stimulation (tDCS) on the motor cortex for various experimental painful conditions and clinical pain disorders, it is plausible that tDCS can be effective for the severe and medication-refractory PDM patients. This study aim to investigate the analgesic efficacy of tDCS in severe PDMs and to elucidate the dynamic brain neuroplasticity in the context of experimental pain after tDCS intervention. Thirty severe PDMs will be recruited and randomly allocated to either real or sham group in a triple-blind manner. Experimental pain electrical stimulation will be performed before and after the tDCS intervention. The experimental pain-evoked magnetoencephamographic (MEG) data will be correlated with behavioral and psychological measurements. This is the first study in the literature investigating the tDCS efficacy for acute pain in severe PDM. The result can promise a new possibility for clinical application.

NCT03608215 Primary Dysmenorrhea Device: Active tDCS Device: Sham tDCS

MeSH:Dysmenorrhea

HPO:Dysmenorrhea

Primary Outcomes

Description: pain scale; from 0 to 10; score 0: no pain, score 10: unbearable pain

Measure: Visual Analog Scale (VAS)

Description: Somatosensory evoked magnetic fields (SEFs) is a well established magnetoencephalographic (MEG) cortical response evoked by electric stimulation. SEFs to experimental pain stimulation using electrical stimulator applied on the skin over the trajectory of median nerve will be used to evaluate pain-evoked cortical response.

Measure: Somatosensory evoked magnetic fields to experimental pain

Secondary Outcomes

Measure: Quantitative sensory testing (QST)

Description: To assess anxious symptoms; from 20 to 80; score 20: not anxious, score 80: extremely anxious

Measure: Spielberger State-Trait Anxiety Inventory (STAI)

Description: To assess anxious symptoms; from 0 to 63; score 0: not anxious, score 63: extremely anxious

Measure: Beck Anxiety Inventory (BAI)

Description: To assess depressive symptoms; from 0 to 63; score 0: not depressed, score 63: extremely depressed

Measure: Beck Depression Inventory (BDI)

Description: To assess pain-maladaptive psychological status; from 0 to 52; score 0: not pain Catastrophizing , score 52: extremely pain Catastrophizing

Measure: Pain Catastrophizing Scale (PCS)

Description: To assess pain status; from 0 to 78; score 0: not painful, score 78: extremely painful

Measure: Long-form McGill Pain Questionnaire (MPQ)

Measure: Short-Form Health Survey (SF-36)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

Description: To assess testosterone, progesterone, estrogen

Measure: Blood Hormones Measurement

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase)

Measure: Genotyping

Time: baseline

Description: To assure blinding efficacy; Patients do self-assessment about whether they receive real tDCS or sham tDCS. Assessment questionnaire:1 or 0. 1: real tDCS; 0: sham tDCS.

Measure: Efficacy of tDCS blinding

Time: At 1 months after tDCS intervention

5 The Role of Sex Steroids and Serotonin Brain Dynamics in Perinatal Mental Health

Hormonal transitions such as across pregnancy and postpartum may trigger depressive episodes in some women. It is not known why, but estrogen sensitivity may play a critical role. A preclinical human risk model showed that depressive symptoms induced by pharmacological sex-hormone manipulation is linked to increases in serotonin transporter (SERT) brain binding, which lowers serotonergic brain tone. It is currently unknown if these findings translates to women across pre- to postpartum transitions. This longitudinal project studies a group of women who will deliver by planned caesarian, thus permitting the collection of cerebrospinal fluid (csf) containing central markers of serotonergic signaling, at the latest point in pregnancy. The women are followed across late pregnancy, delivery and 6 months postpartum to illuminate relations between sex-hormones, stress-regulation, estradiol sensitivity, csf markers of neurotransmission, serotonin transporter genotype variance, and potential development of subclinical or manifest depressive symptoms. Further, markers of relevance for the infant brain development and stress-regulation will be obtained from placenta tissue and umbilical cord blood. A subgroup of 70 women will participate in a brain imaging program early postpartum (week 3-5), which includes an evaluation of brain activity and structure and in vivo molecular brain imaging serotonergic markers. Thus, serotonergic markers in csf can be combined with postpartum molecular brain imaging of key features of serotonin signaling. Women in the imaging program are selected based on variation in their level of mental distress immediately postpartum (day 2-5). The study's main hypothesis is that women with high-expressing SERT genotypes are more sensitive to peripartum hormonal transition in terms of changes in serotonergic tone and emergence of depressive symptoms and that such an association will be stronger in the presence of candidate gene transcript biomarkers of oestrogen sensitivity. A further hypothesis is that in vivo molecular brain imaging and csf based serotonergic markers will be associated with depressive symptoms both early and later postpartum. Ideally, this project will provide a rationale for future targeted prevention and/or treatment of perinatal depression in women at high risk, which holds grand potential to protect not only mother but also infant brain health long-term.

NCT03795688 Major Depressive Disorder Perinatal Depression Other: Pregnancy

MeSH:Depressive Disorder Depressive Disorder, Major

HPO:Depressivity

BDNF genotype (rs6265) status, i.e. val/val versus met-carrier variants.

BDNF val66met (rs6265) status, binary variable, i.e. "val/val" versus "met-carrier" status.

Primary Outcomes

Description: Edinburgh Postnatal Depression Scale. Score range: 0-30. Higher scores indicate more symptoms of postpartum depression. Total group

Measure: Depressive symptoms

Time: Week 3-6 postpartum

Description: Score on the Hamilton 17-item depression scale. Score range: 0-52. Higher scores indicate more depressive symptoms. Assessed in imaging group

Measure: Depressive symptoms

Time: Week 3-6 postpartum

Description: 116 a priori defined gene transcripts, which where differentially expressed in third trimester of women who later developed perinatal depression with postpartum onset relative to pregnant women who did not and to other depressed (reference Mehta et al, 2014, Psychological Medicine) and confirmed to be coupled to estrogen fluctuations (Mehtaet al. 2018 British Journal of Psychiatry) will be evaluated in the total group. Also DNA methylation of the genes of these transcripts will be determined and analysed in terms of their predictive value (above chance) for perinatal depression.

Measure: Gene transcript and DNA methylation markers of estrogen sensitivity

Time: Prior to caesarean section

Description: Latent variable construct of brain 5-HT4R level based on quantification of 5-HT4R binding from 11C-SB207145 positron emission tomography in primary volumes of interest; neocortex, nucleus caudatus, putamen and hippocampus. Assessed in imaging group.

Measure: Cerebral serotonin 4 receptor binding postpartum

Time: Week 3-6 postpartum

Description: Assessed in total group

Measure: CSF levels of GABA

Time: On day of caesarean section

Description: Assessed in total group

Measure: CSF levels of serotonin metabolite (5-HIAA)

Time: On day of caesarean section

Description: Cortisol awakening response, area under the curve with respect to baseline from 0 to 60 minutes from awakening.

Measure: Cortisol awakening response

Time: Week 3-6 postpartum

Description: Provides an estimate of cortisol exposure up to 6 months prior to delivery, total group

Measure: Hair cortisol level mothers

Time: On day of caesarean section.

Description: Provides an estimate of fetal cortisol exposure, infants from total group

Measure: Hair cortisol level newborns

Time: Day 0-5 postpartum.

Description: Hippocampal brain volume (including hippocampus) from structural MRI, imaging group.

Measure: Hippocampal volumes

Time: Week 3-6 postpartum.

Description: fMRI (BOLD response) based assessment of brain activity in response to reward, relative to non-reward, stimuli. Assessed in imaging cohort

Measure: functional MRI response to reward

Time: Week 3-6 postpartum.

Description: rsfMRI based spontaneous co-fluctuations in low frequency BOLD signal, (functional connectivity). Assessed with rsfMRI scan in the resting state, i.e. non-goal oriented spontaneous thought and awake. Assessed in imaging group.

Measure: Resting state functional connectivity MRI

Time: Week 3-6 postpartum

Description: Change in epigenetic SERT status from late pregnancy to postpartum week 3-6.

Measure: Change in epigenetic SERT status

Time: From just before delivery to 3-6 weeks postpartum

Description: Composite measure of hsCRP, TNF-α, IL-6, IL-18 and IL-10 levels, total group

Measure: Concentration of inflammatory markers, i.e hsCRP and immunoactive cytokines, in peripheral blood

Time: At week 3-6

Description: fMRI (BOLD response) based assessment of brain activity to emotionally salient, relative to neutral, stimuli. Assessed in imaging cohort.

Measure: functional MRI response to emotional faces

Time: Week 3-6 postpartum.

Secondary Outcomes

Description: Score on the Hamilton 17-item depression scale. Score range: 0-52. Higher scores indicate more depressive symptoms. Assessed in imaging group

Measure: Depressive symptoms

Time: Day 3-5 postpartum

Description: Score on the Hamilton 17-item depression scale. Score range: 0-52. Higher scores indicate more depressive symptoms. Assessed in imaging group

Measure: Depressive symptoms

Time: Week 12 postpartum

Description: Edinburgh Postnatal Depression Scale. Score range: 0-30. Higher scores indicate more symptoms of postpartum depression. Assessed in total group

Measure: Depressive symptoms

Time: Day 3-5 postpartum

Description: Edinburgh Postnatal Depression Scale. Score range: 0-30. Higher scores indicate more symptoms of postpartum depression. Assessed in all

Measure: Depressive symptoms

Time: 6 months postpartum

Description: Assessed in total group

Measure: CSF levels of serotonin

Time: On day of caesarean section

Description: Assessed in total group

Measure: CSF levels of dopamine metabolites

Time: On day of caesarean section

Description: Assessed in total group

Measure: CSF levels of noradrenaline metabolites

Time: On day of caesarean section

Description: Composite measure of IFN-c, IFN-alfa TNF-alfa og IL-6, in total group

Measure: CSF levels of inflammatory markers

Time: On day of caesarean section

Description: Estradiol level in peripheral blood, total group

Measure: Estradiol level

Time: Prior to caesarean section.

Description: Estradiol level peripheral blood, total group

Measure: Estradiol level

Time: At week 3-6 postpartum.

Description: Estradiol change pre- to postpartum, peripheral blood total group

Measure: Change in estradiol level

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Progesterone level in peripheral blood

Measure: Progesterone level

Time: Prior to caesarean section.

Description: Progesterone level in peripheral blood

Measure: Progesterone level

Time: At week 3-6 postpartum.

Description: Progesterone change pre- to postpartum, peripheral blood total group

Measure: Change in progesterone level

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Allopregnanolone level in peripheral blood

Measure: Allopregnanolone level

Time: Prior to caesarean section.

Description: Allopregnanolone level in peripheral blood

Measure: Allopregnanolone level

Time: At week 3-6 postpartum.

Description: Change in allopregnanolone level in peripheral blood

Measure: Change in allopregnanolone level

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Cortisol change pre- to postpartum, peripheral blood total group

Measure: Change in cortisol level

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Cortisol awakening response, area under the curve with respect to baseline from 0 to 60 minutes from awakening.

Measure: Cortisol awakening response

Time: Week 12 postpartum

Description: Cortisol awakening response, area under the curve with respect to baseline from 0 to 60 minutes from awakening.

Measure: Cortisol awakening response

Time: Prior to caesarean section

Description: Change in cortisol awakening response, from caesarean section to 3-6 weeks postpartum.

Measure: Change in cortisol awakening response

Time: ´From baseline (caesarean section to week 3-6 postpartum)

Description: Methylation status for the SERT gene, total group

Measure: DNA methylation of the SERT gene

Time: Prior to caesarean section

Description: DNA Methylation status for the SERT gene, total group

Measure: DNA methylation of the SERT gene

Time: Week 3-6 postpartum

Description: Methylation status for the FK506-binding protein 51 (FKBP5) gene, total group

Measure: DNA methylation of the FK506-binding protein 51 (FKBP5) gene

Time: Prior to caesarean section.

Description: Methylation status for the FK506-binding protein 51 (FKBP5) gene, total group

Measure: DNA methylation of the FK506-binding protein 51 (FKBP5) gene

Time: Week 3-6 postpartum

Description: Change in methylation status for the FK506-binding protein 51 (FKBP5) gene from late pregnancy to postpartum week 3-6.

Measure: Change in DNA methylation of the FK506-binding protein 51 (FKBP5) gene

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Methylation status for the glucocorticoid receptor gene, total group

Measure: DNA methylation of the glucocorticoid receptor gene

Time: Prior to caesarean section.

Description: Methylation status for the glucocorticoid receptor gene, total group

Measure: DNA methylation of the glucocorticoid receptor gene

Time: Week 3-6 postpartum

Description: Change in methylation status for the glucocorticoid receptor gene from late pregnancy to postpartum week 3-6.

Measure: Change in DNA methylation of the glucocorticoid receptor gene

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Methylation status for the COMT gene, total group

Measure: DNA methylation of the COMT gene

Time: Prior to caesarean section.

Description: Methylation status for the COMT gene, total group

Measure: DNA methylation of the COMT gene

Time: Week 3-6 postpartum

Description: Change in methylation status for the COMT gene from just before delivery to 3-6 weeks postpartum

Measure: Change in DNA methylation of the COMT gene

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Methylation status for the MAO-A gene, total group

Measure: DNA methylation of the MAO-A gene

Time: Prior to caesarean section.

Description: Change in methylation status for the MAO-A gene, total group

Measure: Change in DNA methylation of the MAO-A gene

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Methylation status for the MAO-A gene, total group

Measure: DNA methylation of the MAO-A gene

Time: Week 3-6 postpartum

Description: Methylation status for the oxytocin receptor gene, total group

Measure: DNA methylation of the oxytocin receptor gene

Time: Prior to caesarean section.

Description: Methylation status for the oxytocin receptor gene, total group

Measure: DNA methylation of the oxytocin receptor gene

Time: Week 3-6 postpartum

Description: Change in methylation status for the oxytocin receptor gene, total group

Measure: Change in DNA methylation of the oxytocin receptor gene

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Methylation status for the oxytocin gene, total group

Measure: DNA methylation of the oxytocin gene

Time: Prior to caesarean section.

Description: Methylation status for the oxytocin gene, total group

Measure: DNA methylation of the oxytocin gene

Time: Week 3-6 postpartum

Description: Change methylation status for the oxytocin gene, total group

Measure: Change in DNA methylation of the oxytocin gene

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Composite measure of hsCRP, TNF-α, IL-6, IL-18 and IL-10 levels, total group

Measure: Systemic inflammation peripheral blood hsCRP and immunoactive cytokines

Time: Prior to caesarean section.

Description: Change in composite measure of hsCRP, TNF-α, IL-6, IL-18 and IL-10 levels, total group

Measure: Change in systemic inflammation peripheral blood hsCRP and immunoactive cytokines

Time: From baseline (caesarean section to week 3-6 postpartum

Description: Family History Assessment Module (OS-FHAM). Number of first degree relatives with a history of depressive episodes or bipolar disorder. Total group.

Measure: Self reported family history of mood disorders

Time: Day 3-5 postpartum or before

Description: Barratt Impulsiveness Scale (BIS-11), self-reported. Range: 30-120. Total group.

Measure: Self reported impulsiveness score

Time: Day 3-5 postpartum or before

Description: NEO-PI-R - Revised NEO Personality Inventory, self-reported. Participants may score 20-80 for each of the personality traits: openness, conscientiousness, extraversion, agreeableness, and neuroticism. The higher the score, the more prominent is the personality trait. Total group.

Measure: Self reported Neuroticism score from NEO personality questionnaire

Time: Day 3-5 postpartum or before

Description: Parental bonding instrument (PBI), both parents, self-reported. Total group.

Measure: Self reported parental bonding quality

Time: Day 3-5 postpartum or before

Description: Perceived Stress Scale (PSS), range 0-40, a score of 0 indicates no perceived stress. Total group.

Measure: Self-reported perceived stress

Time: Day 3-5 postpartum

Description: Perceived Stress Scale (PSS), range 0-40, a score of 0 indicates no perceived stress. Total group.

Measure: Self-reported perceived stress

Time: Week 3-6 postpartum

Description: Change in Perceived Stress Scale (PSS), range 0-40, a score of 0 indicates no perceived stress. Total group.

Measure: Change in self-reported perceived stress

Time: Change from day 3-5 to week 3-6 postpartum

Description: Snaith-Hamilton Pleasure Scale (SHAPS), range 0-14, a score of 0 indicates no self-reported anhedonia. Total group.

Measure: Self-reported anhedonia

Time: Day 3-5 postpartum

Description: Snaith-Hamilton Pleasure Scale (SHAPS), range 0-14, a score of 0 indicates no self-reported anhedonia. Total group.

Measure: Self-reported anhedonia

Time: Week 3-6 postpartum

Description: Change in Snaith-Hamilton Pleasure Scale (SHAPS) score, range 0-14, a score of 0 indicates no self-reported anhedonia. Total group.

Measure: Change in self-reported anhedonia

Time: Change from day 3-5 to week 3-6 postpartum

Description: Rumination Response Scale (RRS), range 22-88, a score of 22 indicates no ruminative symptoms. Total group.

Measure: Self-reported rumination

Time: Day 3-5 postpartum

Description: Rumination Response Scale (RRS), range 22-88, a score of 22 indicates no ruminative symptoms. Total group.

Measure: Self-reported rumination

Time: Week 3-6 postpartum

Description: Change in Rumination Response Scale (RRS) score, range 22-88, a score of 22 indicates no ruminative symptoms. Total group.

Measure: Change in elf-reported rumination

Time: Change from day 3-5 to week 3-6 postpartum

Description: Profile of Mood States (POMS), range 0-260, a score of 0 indicates no mood disturbance. Total group.

Measure: Self-reported mood

Time: Day 3-5 postpartum

Description: Profile of Mood States (POMS), range 0-260, a score of 0 indicates no mood disturbance. Total group.

Measure: Self-reported mood

Time: Week 3-6 postpartum

Description: Change in Profile of Mood States (POMS) score, range 0-260, a score of 0 indicates no mood disturbance. Total group.

Measure: Change in self-reported mood

Time: Change from day 3-5 to week 3-6 postpartum

Description: Pittsburgh Sleep Quality Index (PSQI), range 0-21, a score of 0 indicates a healthy sleep quality. Total group.

Measure: Self-reported sleep quality

Time: Day 3-5 postpartum

Description: Pittsburgh Sleep Quality Index (PSQI), range 0-21, a score of 0 indicates a healthy sleep quality. Total group.

Measure: Self-reported sleep quality

Time: Week 3-6 postpartum

Description: Change in Pittsburgh Sleep Quality Index (PSQI), range 0-21, a score of 0 indicates a healthy sleep quality. Total group.

Measure: Change in self-reported sleep quality

Time: Change from day 3-5 to week 3-6 postpartum

Description: Brief symptom Inventory-53 item (BSI-53), range 0-212, increasing score means worsening of symptoms.Total group.

Measure: Self-reported psychiatric symptoms

Time: Day 3-5 postpartum

Description: Brief symptom Inventory-53 item (BSI-53), range 0-212, increasing score means worsening of symptoms.Total group.

Measure: Self-reported psychiatric symptoms

Time: Week 3-6 postpartum

Description: Change in Brief symptom Inventory-53 item (BSI-53) score, range 0-212, increasing score means worsening of symptoms.Total group.

Measure: Change in self-reported psychiatric symptoms

Time: Change from day 3-5 to week 3-6 postpartum

Description: WHO-5 well-being index, range 0-100, low score means less well-being. Total group.

Measure: Self-reported well-being

Time: Day 3-5 postpartum

Description: WHO-5 well-being index, range 0-100, low score means less well-being. Total group.

Measure: Self-reported well-being

Time: Week 3-6 postpartum

Description: Change in WHO-5 well-being index, range 0-100, low score means less well-being. Total group.

Measure: Change in self-reported well-being

Time: Change from day 3-5 to week 3-6 postpartum

Description: State Trait Anxiety Inventory (STAI-AD-D), state and trait subscales each have a range of 20-80, 20 means no anxiety. Total group.

Measure: Self-reported anxiety

Time: Day 3-5 postpartum

Description: State Trait Anxiety Inventory (STAI-AD-D), state subscale range 20-80, 20 means no anxiety. Total group.

Measure: Self-reported anxiety

Time: Week 3-6 postpartum

Description: Change in State Trait Anxiety Inventory (STAI-AD-D) score, state subscale range 20-80, 20 means no anxiety. Total group.

Measure: Change in self-reported anxiety

Time: Change from day 3-5 to week 3-6 postpartum

Description: Obsessive-Compulsive Inventory (OCI) score, self-reported, range 0-72, higher scores indicate more symptoms. Total group.

Measure: Self-reported obsessive and compulsive symptoms

Time: Day 3-5

Description: Obsessive-Compulsive Inventory (OCI) score, self-reported, range 0-72, higher scores indicate more symptoms. Total group.

Measure: Self-reported obsessive and compulsive symptoms

Time: Week 3-6 postpartum

Description: Change in Obsessive-Compulsive Inventory (OCI) score, self-reported, range 0-72, higher scores indicate more symptoms. Total group.

Measure: Change in self-reported obsessive and compulsive symptoms

Time: Change from day 3-5 to week 3-6 postpartum

Description: Performance on Simple Reaction Time, in imaging cohort.

Measure: Performance on Simple Reaction Time

Time: Week 3-6 postpartum

Description: Gray matter brain volume prefrontal cortex and anterior cingulate cortex

Measure: Gray matter brain volume prefrontal cortex and anterior cingulate cortex

Time: At week 3-6 postpartum

Description: Composite measure of serotonin, tryptophan og tryptofan hydroxylase levels relative to 5-HIAA, in placenta sample. Infants from total group

Measure: Serotonergic turnover in placenta

Time: At delivery.

Description: 11-beta-hydroxysteroid dehydrogenase type 2 activity in placenta. Infants from total group

Measure: 11-beta-hydroxysteroid dehydrogenase type 2 activity in placenta

Time: At delivery

Description: Composite measure of methylation status for the FKBP5, glucocorticoid receptor, 11-beta hydroxysteroid dehydrogenase type 2 genes. Infants from total group

Measure: Methylation status of genes relevant for stress-hormone regulation in placenta

Time: At delivery

Description: Composite measure of the methylation status for monoamine oxidase, serotonin receptor and serotonin transporter genes. Infants from total group

Measure: Methylation status of genes related to serotonergic signaling in placenta

Time: At delivery

Description: Composite measure of methylation status and gene transcript profiles of Glucocorticoid receptor, FKBP5, oxytocin and oxytocin receptors, Brain-derived neurotrophic factor (BDNF) genes. Assessed in blood from umbilical cord blood sample from infants, total group.

Measure: Methylation status and gene transcript profiles of relevance for early brain development and stress regulation in newborn infants

Time: At delivery.

Other Outcomes

Description: val158met (rs4680) status, binary variable, i.e. "val/val, val/met" vs "met/met" variants

Measure: COMT-genotype (rs4680) variant, i.e met/met vs other polymorphisms

Time: Prior to caesarean section.

Description: BDNF val66met (rs6265) status, binary variable, i.e. "val/val" versus "met-carrier" status

Measure: BDNF genotype (rs6265) status, i.e. val/val versus met-carrier variants

Time: Prior to caesarean section.

Description: 5-HTTLPR genotype status (binary), i.e. high-expressing LALA vs low-expressing (S or LG) variants, based on SLC6A4, i.e. L or S variants, and further subtyping on rs25531 haplotype L(A)L(A) vs LGLA, LGLG or variants containing as S as specified above.

Measure: 5-HTT genotype status, i.e LALA vs low-expressing (S or LG) variants

Time: Prior to caesarean section.

Description: In house interview based on Kennerley Maternity Blues Questionnaire, range: 0-28, higher score indicates more severe postpartum blues symptoms. High blues score is associated with greater risk for perinatal depression at week 3-6.

Measure: Postpartum blues symptoms

Time: Day 3-5 postpartum.

Description: In house interview based on Stein's Maternity Blues Scale, range 0-26. High blues score is associated with greater risk for perinatal depression at week 3-6.

Measure: Postpartum blues symptoms

Time: Day 3-5 postpartum.

6 Clinical, Psychological and Genetic Characteristics of Patients With Atopic Dermatitis and Psoriasis

Atopic dermatitis (AD) and psoriasis (PS) are chronic, relapsing dermatological disorders with a high rate of psychiatric co-morbid pathology represented with depression. Brain Derived Neurotrophic Factor (BDNF) belongs to the neurotrophin family and widely studied in pathophysiology of psychiatric and dermatological disorders. A biological stress response system by altered hypothalamic-pituitary-adrenal (HPA) axis as well hypothalamic-pituitary-gonadal (HPG) axis may contribute to dermatoses and psychiatric disorders development. Various factors including gender, genetic, psychological stress, socioeconomic factors also affect the course of dermatoses. A 10-week, case-control study evaluate clinical, psychological and biochemical parameters in AD and PS patients, and healthy control volunteers (HC) depending on gender and BDNF rs6265 gene polymorphism. All parameters are evaluated twice: at disease exacerbation (study baseline) and week 10. The following methods are conducted: assessment of dermatological status, using Scoring of Atopic Dermatitis (SCORAD) and Psoriasis Area and Severity Index (PASI); assessment of depression and anxiety according to DSM-V criteria and with Hamilton Depression Rating Scale (HAM-D) and with Hamilton Anxiety Rating Scale (HAM-A); analysis of serum BDNF (ng/ml), cortisol (nmol/L), testosterone (ng/dL) and IgE levels (IU/ml, AD only); DNA extraction and genotyping of BDNF variants.The study will last during 4-5 months.

NCT03831646 Atopic Dermatitis Psoriasis

MeSH:Dermatitis, Atopic Psoriasis Dermatitis Eczema

HPO:Atopic dermatitis Eczema Eczematoid dermatitis Inflammatory abnormality of the skin Palmoplantar pustulosis Psoriasiform dermatitis

A 10-week, case-control study evaluate clinical, psychological and biochemical parameters in AD and PS patients, and healthy control volunteers (HC) depending on gender and BDNF rs6265 gene polymorphism.

DNA extraction and genotyping the BDNF rs6265 (Val66Met) gene polymorphism in AD, PS and HC.

Assessment of testosterone/cortisol ratio in EAD, IAD, PS patients and HC in accordance with BDNF rs6265 gene polymorphism and gender.

Assessment of testosterone/cortisol ratio in EAD, IAD, PS patients and HC divided into BDNF rs6265 gene polymorphism (Val/Val; Val/Met; Met/Met) and gender (males, females) at study baseline and week 10.

Correlation analysis of dermatological, psychological and biochemical parameters in EAD, IAD and PS patients, and HC divided into groups in accordance with BDNF rs6265 gene polymorphism (Val/Val; Val/Met; Met/Met) and gender (males, femaes).

This study evaluate clinical, psychological and biochemical parameters in AD and PS patients depending on gender and BDNF rs6265 gene polymorphism.

Primary Outcomes

Description: Assessment of atopic dermatitis severity is conducted using Scoring of Atopic Dermatitis (SCORAD) index. SCORAD index formula is: A/5 + 7B/2 + C. In this formula A is defined as the extent (0-100), B is defined as the intensity (0-18) and C is defined as the subjective symptoms (0-20). The maximum SCORAD score is 103. SCORAD <23 - mild AD; SCORAD from 23 to 63 - moderate AD; SCORAD> 63 - severe AD.

Measure: Assessment of change in the severity of atopic dermatitis after conventional treatment from study onset (baseline) at week 10

Time: At disease onset (study baseline) and at week 10

Description: Assessment of the psoriasis severity is conducted using Psoriasis Area and Severity Index (PASI). The patient's body is divided into four sections (head (H) (10% of a person's skin); arms (A) (20%); trunk (T) (30%); legs (L) (40%)). The percent of skin lesions of each area is assessed as follows: 0 (0% of involved area); 1 (< 10%); 2 (10-29%); 3 (30-49%); 4 (50-69%); 5 (70-89%); 6 (90-100%). Further, for each region, the intensity of 3 clinical signs is evaluated - redness, thickness and scaling and assessed as follows: 0 - no lesions,1 - easy, 2 - moderate, 3 - severe, 4 - very severe. The sum of all three severity parameters is calculated for each section, multiplied by the area score for that area and multiplied by weight of respective section (0.1 for head, 0.2 for arms, 0.3 for body, 0.4 for legs). PASI range is from 0 (no disease) to 72 (maximum disease). The severity of psoriasis is assessed as follows: PASI <20 - mild; PASI from 20 to 50 - moderate; PASI> 50 - severe

Measure: Assessment of change in the severity of psoriasis after conventional treatment from study onset (baseline) at week 10

Time: At disease onset (study baseline) and at week 10

Description: Depression is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Depression Rating Scale (HAM-D) using the following ranges: absence, ≤7; mild, 8-16; moderate, 17-27; severe, ≤28

Measure: Assessment of change in the severity of depression in atopic dermatitis and psoriasis patients after conventional treatment from study onset (baseline) at week 10

Time: At disease onset (study baseline) and week 10

Measure: Assessment of the severity of depression in healthy controls (HC)

Time: At disease onset (study baseline)

Description: Anxiety is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Anxiety Rating Scale (HAM-A) using the following ranges: ≤17, easy; 18-24, moderate; over 25, medium-severe

Measure: Assessment of change in the severity of anxiety in atopic dermatitis and psoriasis patients after conventional treatment from study onset (baseline) at week 10

Time: At disease onset (study baseline) and week 10

Measure: Assessment of the severity of anxiety in HC

Time: At disease onset (study baseline)

Description: The total IgE levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 0.000-100.0 IU/ml

Measure: Evaluation of changes in serum immunoglobulin E (IgE, IU/ml) levels from study onset (baseline) at week 10 in atopic dermatitis patients

Time: At disease onset (study baseline) and week 10

Measure: Analysis of serum IgE (IU/ml) levels in HC

Time: At disease onset (study baseline)

Description: Serum BDNF levels are analyzed using a solid-phase, sandwich, two-site, ELISA (Promega, US; G7610). No measurement scale is used

Measure: Evaluation of changes in serum Brain Derived Neurotrophic Factor (BDNF, ng/ml) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients

Time: At disease onset (study baseline) and week 10

Description: Serum BDNF levels are analyzed using a solid-phase, sandwich, two-site, ELISA (Promega, US; G7610). No measurement scale is used

Measure: Analysis of serum BDNF (ng/ml) levels in HC

Time: At disease onset (study baseline)

Description: The total cortisol levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 138-690 nmol/L

Measure: Evaluation of changes in cortisol (nmol/L) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients

Time: At disease onset (study baseline) and week 10

Measure: Analysis of serum cortisol (nmol/L) levels in HC

Time: At disease onset (study baseline)

Description: The total testosterone levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: men 20-49 years - 72 -853ng/dL; men≥50 years -129-767 ng/dL; women ovulating - 0.010-73.0 ng/dL; women postmenopausal - 0.010-43.0 ng/dL.

Measure: Evaluation of changes in testosterone (ng/dL) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients

Time: At disease onset (study baseline) and week 10

Measure: Analysis of serum testosterone (ng/dL) levels in HC

Time: At disease onset (study baseline)

Description: DNA extraction and genotyping the BDNF rs6265 (Val66Met) gene polymorphism in AD, PS and HC

Measure: DNA extraction in AD, PS and HC

Time: At disease onset (study baseline)

Secondary Outcomes

Description: EAD and IAD patients will be divided into subgroups in accordance with BDNF gene polymorphism and gender with following assessment of SCORAD scores compared with baseline after conventional treatment at week 10 in each group using unpaired t-test

Measure: Assessment and comparison (Unpaired t-test) of SCORAD scores in extrinsic atopic dermatitis (EAD, IgE level above the normal) and intrinsic atopic dermatitis (IAD, normal IgE level) patients compared with baseline after conventional treatment at week 10

Time: At disease onset (study baseline) and week 10

Description: Psoriasis patients will be divided into subgroups in accordance with BDNF gene polymorphism and gender with following assessment of PASI scores compared with baseline after conventional treatment at week 10 in each group.

Measure: Assessment and comparison (Unpaired t-test) of PASI scores in psoriasis patients compared with baseline after conventional treatment at week 10 in accordance with BDNF gene polymorphism (Val/Val; Val/Met;Met/Met) and gender(males, females)

Time: At disease onset (study baseline) and week 10

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of HAM-D scores in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of HAM-D scores in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of HAM-D scores in EAD, IAD, PS and HC

Time: At disease onset (study baseline) and week 10

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of HAM-A scores in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of HAM-A scores in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of HAM-A scores in EAD, IAD,PS and HC

Time: At disease onset (study baseline) and week 10

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of serum BDNF(ng/ml) levels in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of serum BDNF levels in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of serum BDNF (ng/ml) levels in EAD, IAD,PS and HC

Time: At disease onset (study baseline) and at week 10

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for comparisons of serum cortisol (nmol/L) levels in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of serum cortisol levels in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of serum cortisol (nmol/L) levels in EAD, IAD,PS and HC

Time: At disease onset (study baseline) and at week 10

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of serum testosterone (ng/dL) levels in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of serum testosterone levels in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of serum testosterone (ng/dL) levels in EAD, IAD,PS and HC

Time: At disease onset (study baseline) and at week 10

Description: Assessment of testosterone/cortisol ratio in EAD, IAD, PS patients and HC divided into BDNF rs6265 gene polymorphism (Val/Val; Val/Met; Met/Met) and gender (males, females) at study baseline and week 10

Measure: Assessment of testosterone/cortisol ratio in EAD, IAD, PS patients and HC in accordance with BDNF rs6265 gene polymorphism and gender

Time: At disease onset (study baseline) and at week 10

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of testosterone/cortisol ratio in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of testosterone/cortisol ratio in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of testosterone/cortisol ratio in EAD, IAD, PS and HC

Time: At disease onset (study baseline) and at week 10

Description: Correlation analysis of dermatological, psychological and biochemical parameters in EAD, IAD and PS patients, and HC divided into groups in accordance with BDNF rs6265 gene polymorphism (Val/Val; Val/Met; Met/Met) and gender (males, femaes)

Measure: Correlation analysis of studied parameters in dermatological patients and HC

Time: At disease onset (study baseline) and week 10

7 Efficacy and Effectivity of Long Term Home Based tDCS in Fibromyalgia: an Explanatory Randomized Clinical Trial

Fibromyalgia(FM) is a widespread musculoskeletal pain syndrome characterized by fatigue, sleep disorders, cognitive impairment, depressive symptoms and neuro-vegetative symptoms. It is a multivariable and complex neurobiological process. FM worldwide prevalence according to American College of Rheumatology (ACR) 2010 diagnostic criteria is estimated under 5,4%. In USA the burden caused by FM is estimated at 29 billions every year, due to assistance, health care costs and retirement to loss of productivity. It is known that conventional pharmacological approaches present poor therapeutic response in more than 50% of these patients. It is conceivable that this limited results, at least in part, due to the lack of a complete elucidation of its pathophysiology. Our hypothesis is that tDCS has a superior effect on clinical outcomes, functional capacity, cortical excitability, and psycho-affective functions compared to simulated treatment. In order to respond to the objectives of this study, a randomized, parallel-blinded clinical trial will be conducted. FM patients will be randomized to receive tDCS with anodic pole on the primary motor cortex and the cathode pole on the contralateral prefrontal cortex.

NCT03843203 Fibromyalgia Transcranial Direct Current Stimulation Device: Transcranial Direct Current Stimulation - tDCS

MeSH:Fibromyalgia Myofascial Pain Syndromes

Blood samples will be collected at baseline in order to determine BDNF gene polymorphism for the G allele (rs6265).

Primary Outcomes

Description: Change from before and after the First phase of treatment on Pain scores assessed by a visual analogue scale (VAS 0 to 100mm) (0 means no pain - 100 means the worst pain imaginable)

Measure: Change in pain level - first phase

Time: 1 month

Description: Change from before and after the First phase of treatment on Total score on the Brazilian Profile of Chronic Pain: Screen (BPCP:S) (range from 0 to 93; high numbers means more pain severity, interference in daily activities and emotional burden)

Measure: Change in functional capacity - first phase

Time: 1 month

Secondary Outcomes

Description: Change from before and after the Second phase of treatment on Pain scores assessed by a visual analogue scale (VAS 0 to 100mm) (0 means no pain - 100 means the worst pain imaginable)

Measure: Change in pain level - second phase

Time: 3 months

Measure: Change in functional capacity - second phase

Time: 3 months

Description: Change from before and after the First phase of treatment on the score in a numerical pain scale (NPS 0-10) for a moderate heat pain stimulus to the right arm (ventral region) during a conditioned pain modulation task (CPM-task), where participant keeps the counter-lateral hand in an iced cold water (0 to 1º Celsius)

Measure: Change in Function of modulatory descending system

Time: 1 month

Description: Change from before and after the First phase of treatment on measures of motor threshold (MT), motor evoked potential (MEP), intracortical facilitation (ICF), short intracortical inhibition (SICI), and cortical silent period (CSP) assessed with transcranial magnetic stimulation (TMS).

Measure: Change in Function of corticospinal pathway

Time: 1 month

Description: Blood samples will be collected at baseline and after the First phase of intervention in order to determine BDNF serum levels using a standardized kit

Measure: Change in levels of Brain derived neurotrophic factor - BDNF

Time: 1 month

Description: Blood samples will be collected at baseline in order to determine BDNF gene polymorphism for the G allele (rs6265)

Measure: Polymorphism of Brain derived neurotrophic factor - BDNF

Time: 10 minutes

8 Interventional Study of Expiratory Muscle Strength Training as a Treatment in Neuromuscular Disorders

The purpose of this study is to investigate the impact of expiratory muscle strength training (EMST) on the swallowing, breathing, oral intake, quality of life and cough function of people with oculopharyngeal muscular dystrophy (OPMD).

NCT04009408 Oculopharyngeal Muscular Dystrophy Muscular Dystrophies Myopathy; Hereditary Device: Expiratory muscle strength therapy (EMST150, Aspire LLC)

MeSH:Muscular Dystrophies Muscular Diseases Muscular Dystrophy, Oculopharyngeal Neuromuscular Diseases

HPO:Muscular dystrophy Myopathy

We will measure genetic biomarkers associated with swallowing function including rs6265, rs165599, rs10835211, rs17601696, and APOE4 genotype status.

Primary Outcomes

Description: Global swallowing function is rated from videofluoroscopy swallowing studies (VFSS), using the Dynamic Imaging Grade of Swallowing Toxicity (DIGEST), a validated 5-point scale. Global swallowing function is rated from 0-4: 0 = no pharyngeal dysphagia; 1 = mild; 2 = moderate; 3 = severe; 4 = life-threatening. A lower score is a better outcome.

Measure: Global Swallowing Function

Time: Change in score from week 0 to week 5

Secondary Outcomes

Measure: Global Swallowing Function

Time: Change in score from week 0 to week 15; change in score from week 5 to week 15.

Description: MEP is a measure of respiratory muscle strength and is assessed with a handheld manometer, measured in centimetres of water (cmH2O). A higher score is a better outcome.

Measure: Maximum expiratory pressure (MEP)

Time: Change in score from week 0 to week 5; change in score from week 0 to week 15; change in score from week 5 to week 15.

Description: Measure of cough strength that is assessed using a spirometer, measured in litres per minute (L/min). A higher score is a better outcome.

Measure: Volitional cough strength (peak cough flow)

Time: Change in score from week 0 to week 5; change in score from week 0 to week 15; change in score from week 5 to week 15.

Description: Measure of how much air is exhaled during forced exhalation and is assessed with a spirometer, measured in litres. A higher score is a better outcome.

Measure: Forced vital capacity (FVC)

Time: Change in score from week 0 to week 5; change in score from week 0 to week 15; change in score from week 5 to week 15.

Description: A measure daily nutritional and hydration consumption. Oral intake is assessed using the Functional Oral Intake Scale (FOIS), a validated 7-point ordinal scale (1 = no oral intake; 2 = tube dependent with minimal/inconsistent oral intake; 3 = tube supplements with consistent oral intake; 4 = total oral intake in single consistency; 5 = total oral intake of multiple consistencies requiring special preparation; 6 = total oral intake with no special preparation, but must avoid specific foods or liquid items; 7 = total oral intake with no restrictions). A higher score is a better outcome.

Measure: Oral Intake

Time: Change in score from week 0 to week 5; change in score from week 0 to week 15; change in score from week 5 to week 15.

Description: Will be measured using the Eating Assessment Tool-10 (EAT-10), a self-administered, symptom-specific outcome instrument for dysphagia. The EAT-10 allows patients to rate their swallowing symptoms on scale of 0 = no problem to 4 = severe problem. A lower score is a better outcome.

Measure: Self-perceived swallowing impairment

Time: Change in score from week 0 to week 5; change in score from week 0 to week 15; change in score from week 5 to week 15.

Description: An optional blood sample will be collected for biomarker analysis, to identify correlations with clinical response. We will measure genetic biomarkers associated with swallowing function including rs6265, rs165599, rs10835211, rs17601696, and APOE4 genotype status. For these 5 genetic biomarkers, participants will be scored as having zero, one, or two alleles. This information will be used in subgroup analyses for the primary and secondary outcomes.

Measure: Biomarker analyses

Time: Baseline measurement (week 0)

9 Stroke Rehabilomics Study: Epigenetics and Genetics Characterization of the BDNF and SLC6A4 Genes in Patients Undergoing Robotic Rehabilitation Treatment

Stroke is associated with disability and impaired quality of life. Persistent motor impairment is common with incomplete recovery of motor function after rehabilitation, mainly in the upper limbs (UL). Robot-mediated therapy (RMT) has been proposed as a viable approach for the rehabilitation of the UL, but more rigorous studies are needed to tailor rehabilitation and to better address the treatment. Brain-derived neurotrophic factor (BDNF) and the serotonin transporter gene (SLC6A4) have been shown to play an important role in post-stroke recovery. After ischemic stroke, disruption and subsequent reorganization of functional brain connections occur both locally and far from the lesion, with the latter possibly contributing to function recovery. This project aims to assess whether epigenetic and genetic variations of BDNF and SLC6A4 can occur in stroke patients after robotic rehabilitation treatment. This study will allow to identify potential genetic and epigenetic biomarkers in post-stroke rehabilitation that could be used to predict the response to a specific rehabilitation treatment and to choose the optimal treatment for the patient (Rehabilomics).

NCT04223180 Stroke Device: Robotic assisted intervention

MeSH:Stroke

HPO:Stroke

Presence/absence of rs6265 in the BDNF.

BDNF rs6265 polymorphism will be analyzed using HpyCH4IV restriction enzyme which identifies homozygous Valine/Valine, heterozygous Valine/Methionine and homozygous Methionine/Methionine.

Moreover, the investigators will also detect BDNF rs6265 and SLC6A4 5-HTTLPR polymorphisms.

Moreover, BDNF rs6265 polymorphism will be analyzed using HpyCH4IV restriction enzyme which identifies homozygous Valine/Valine, heterozygous Valine/Methionine and homozygous Methionine/Methionine.

Primary Outcomes

Description: BDNF rs6265 polymorphism will be analyzed using HpyCH4IV restriction enzyme which identifies homozygous Valine/Valine, heterozygous Valine/Methionine and homozygous Methionine/Methionine

Measure: Presence/absence of rs6265 in the BDNF

Time: Baseline (T0)

Description: SLC6A4 5-HTTLPR polymorphism will be analyzed by a specific protocol that identifies gene polymorphisms according to the polymerase chain reaction (PCR) fragment sizes: short [S; 486 base pairs (bp), 14 repeats], long [L; 529bp, 16 repeats], or extra-long [XL; 612 or 654bp, 20 or 22 repeats].

Measure: Presence/absence of 5-HTTLPR in the SLC6A4

Time: Baseline (T0)

Secondary Outcomes

Description: Promoter methylation of BDNF using pyrosequencing analysis with PyroMark Q24 (Qiagen, Germany).

Measure: Change in promoter methylation levels of BDNF gene

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

Description: Promoter methylation of SLC6A4 using pyrosequencing analysis with PyroMark Q24 (Qiagen, Germany).

Measure: Change in promoter methylation levels of SLC6A4 gene

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

Other Outcomes

Description: The FMA-UL is a stroke-specific, performance-based impairment index. It is designed to assess motor functioning, sensation and joint functioning in patients with post-stroke hemiplegia. The upper limb portion of the FMA-UL ranges from 0 (hemiplegia) to 66 points (normal upper limb motor performance).

Measure: Change in Fugl-Meyer Assessment of Motor Recovery after Stroke for Upper Extremity portion (FMA-UL)

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

Description: The BI is designed to assess the ability of an individual with a neuromuscular or musculoskeletal disorder to care for him/herself. It ranges from 0 to 100, with a higher number meaning better performance in activities of daily living.

Measure: Change in Modified Barthel Index (BI)

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

Description: The Motricity Index is used to measure strength in upper extremities and ranges from 0 to 100, with higher scores meaning higher strength.

Measure: Change in Motricity Index (MI)

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

Description: SDMT evaluates information processing speed. It consists of a simple task of replacing symbols with numbers. Using a reference key, the patient has 90 seconds to match a sequence of symbols with the correspondent numbers as rapidly as possible. Both written or oral administration can be used.

Measure: Change in Symbol Digit Modalities Test (SDMT)

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

Description: The TOL test is a tool to assess strategic decision and problem solving. The patient is required to move different colored balls on the three pegs of different lengths, according to a model and a number of established moves. The maximum time for each configuration is 60 seconds.

Measure: Tower of London (TOL)

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

Description: The ROCF is a neuropsychological assessment for evaluation of visuospatial abilities, memory, attention, planning, working memory and executive functions. The patient is required to copy a complex figure freehand (recognition), and then draw it from memory (recall). The score is assigned based on the correctness of each line (from 0 to 2).

Measure: Change in Rey-Osterrieth Complex Figure Test (ROCF).

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

Description: The DS is a test that measures the verbal memory span (digit memory). The patient is required to correctly repeat the sequence of number listened. It is composed by two different tests: the Digits Forward and the Digit Backward. The range for Digit Forward is from 6 to -1.

Measure: Change in Digit Span (DS)

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

Description: The SCWT is a neuropsychological test used to assess the cognitive interference. The patient is required to read three different tables as fast as possible (in 30 seconds): the first contains 100 names of colors ink in black; the second contains 100 shapes of different colors (red, blue, green); the third contains 100 color-words are printed in an inconsistent color ink (for instance the word "red" is printed in green ink).

Measure: Change in Stroop and Color Word test (SCWT)

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

Description: The BBT is a tool to measure unilateral gross manual dexterity. Patients are seated at a table, in front of a rectangular box with a partition in the middle. 150 colored, wooden blocks are placed in one compartment. Patients are required to move as many blocks as possible, one at time, from one compartment to the other in a period of 60 seconds. BBT is scored by counting the number of blocks carried over from a compartment to the other one. At the beginning, patients perform a one-minute trial period. Patients have to perform the BBT with both hands.

Measure: Change in Box and Block test (BBT)

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]