Primary Outcomes

Description: averaged percentage of methylation at each CpG site listed

Measure: Brain-derived Neurotrophic Factor (BDNF) DNA Methylation of Major Depressive Disorder (MDD) Patients and Healthy Controls

Time: 2 years

---

Description: Chromatin immunoprecipitation (ChIP) was used to measure histone modification. The unit of our given machine is relative quantification, and a higher value indicated increased histone modification. The detailed method could be found in: Huebert DJ, Kamal M, O'Donovan A, Bernstein BE: Genome-wide analysis of histone modifications by ChIP-on-chip. Methods 2006; 40: 365-369.

Measure: Histone Modification of MDD Patients Before and After Treatment and With Healthy Controls

Time: 2 years

---

Secondary Outcomes

Description: Serum BDNF levels were measured. MDD patients received antidepressant treatment, a standard biological management. Nothing novel (such as experimental drugs or management) is introduced in the treatment, so the research design is observational (of standard treatment). The choice of antidepressant drugs depended on the need of patients in natural treatment procedure. They included selective serotonin reuptake inhibitors (SSRI), eg. fluoxetine or paroxetine.

Measure: BDNF Levels of MDD Patients Before and After Treatment and Healthy Controls

Time: 2 years

---

Primary Outcomes

Description: The POMS questionnaire is an instrument to evaluate mood states. It has 65 items and 6 domains: tension-anxiety, depression, anger-hostility, vigour-activity, fatigue, and confusion- bewilderment. The total mood disturbance score is derived by subtracting the vigour-activity score from the the sum of scores from the other subscales. The iceberg profile is characterized by low raw scores on the tension, depression, anger, fatigue, and confusion scales and above norms (the "water line") on vigor.

Measure: Response of mood states after interventions

Time: Change from 5 minutes before the treatments to 5 and 20 minutes after three exercise intensities and quiet rest

---

Description: Anxiety Inventory-STAI trait-state. The scales encompasses 20 items and provides a one-dimensional measurement of anxiety. Range of scores for each subtest is 20-80, the higher score indicating greater anxiety. A cut point of 39-40 has been suggested to detect clinically significant symptoms.

Measure: Response of anxiety after interventions

Time: Change from 5 minutes before the treatments to 5 and 20 minutes after three exercise intensities and quiet rest

---

Secondary Outcomes

Description: The Physical Activity Readiness Questionnaire (PAR-Q) was originally designed as a screening questionnaire to be self-administered before beginning physical activity. It has been designed to identify the small number of adults for whom physical activity may be inappropriate or those who should have medical advice concerning the type of activity most suitable for them.The people who to answer yes to one or more of seven questions will be advised to consult their doctors before increasing their physical activity. Those who to answer no to all questions will be included in the protocol study.

Measure: Evaluation safety or possible risk of exercising

Time: baseline

---

Description: Habitual Physical Activity Level (BAECKE):The Baecke Questionnaire was developed to measure habitual physical activity. The questionnaire includes items about household activities, sport, and leisure time activities over the past year. The Sport Index is divided into four categories (<1 h; 1-2 hrs; 2-3 hrs; 3-4 hrs and > 4 hrs) and each of these categories has an appropriate coefficient (0.5; 1.5; 2.5; 3.5 and 4.5) Usual daily activity and leisure activity are scored in a range of from 0 to 5. Global PA will be the sum of 3 indexes.

Measure: Habitual Physical Activity Level

Time: Baseline

---

Description: Beck Inventory Anxiety and Depression: The Beck Depression and Anxiety Inventory consists of a self-report questionnaires. These instruments are used to measure the severity of depressive and anxiety episodes.These instruments are widely used by health professionals and researchers in a variety of clinical and research settings. In the Beck Depression Inventory normal score are between 0 and 15; medium depression scores from 15 to 20 (dysphoria), and high depression scores over 20, and in the Beck Anxiety Inventory: 0-9: normal to minimal anxiety;10-18: mild to moderate anxiety;19-29: moderate to severe anxiety and 30-63: severe anxiety.

Measure: Evaluation of depression and anxiety symptoms

Time: Baseline

---

Description: McArdle Step Test was developed to estimate the aerobic capacity of university students. For the test the individual must ascend and descend a step during 3 min with different stepping rates for women and men (22 and 24 steps/min, respective

Measure: Estimation the aerobic capacity

Time: Baseline

---

Description: The detection of the polymorphism in the SLC6A4 gene will be done by the PCR-RFLP method: restriction fragment length polymorphism (RFLP), in which the PCR amplification of the flanking region of the SNP is followed by the digestion reaction with a specific restriction enzyme. The polymorphism of the SLC6A4 gene will be determined by the Polymerase Chain Reaction (PCR) and subsequent gel electrophoresis. PCR will be performed with the following primers forward (GGCGTTGCCGCTCTGAATGC) and reverse (GAGGGACTGAGCTGGACAACCAC).

Measure: Detection of the polymorphism in the SLC6A4

Time: Baseline

---

Description: The BDNF Val66Met SNP rs6265 genotype (G196A) will be obtained, using a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method with forward (5'-ACTCTGGAGAGCGTGAAT-3') and reverse (5'-ATACTGTCACAC ACGCTC-3') primers, and further digestion of the PCR product with NlaIII enzyme (Cat. No. R0125S, New England Biolabs). From the five possible restriction fragments for this Val66Met amplicon, the genotype will be identified by the size and distribution of three bands: 243 bp for the G variant (Val), 168 bp and 75 bp bands for the A variant (Met), and these three bands for GA heterozygotes (Val/Met), on 2.5% (w/v) agarose gel electrophoresis.

Measure: Detection of the polymorphism BDNF Val66Met SNP rs6265 genotype (G196A)

Time: Baseline

---

Primary Outcomes

Description: pain scale; from 0 to 10; score 0: no pain, score 10: unbearable pain

Measure: Visual Analog Scale (VAS)

Time: change from baseline (1st menstrual phase, before tDCS) at one month (2nd menstrual phase, with tDCS), change from baseline (1st menstrual phase, before tDCS) at two months (3rd menstrual phase)

---

Description: Resting-state functional magnetic resonance imaging (rs-fMRI) is a well established method of functional magnetic resonance imaging (fMRI) that is used to evaluate regional interactions in the brain that occur in a resting (task-negative) state, when a subject is not performing an explicit task. Functional connectivity is the connectivity between brain regions that share functional properties, it can be defined as the correlation between spatially remote neurophysiological events, expressed as the neural networks of brain.

Measure: Functional connectivity of rs-fMRI Imaging

Time: change from baseline (before tDCS, before 2nd menstrual phase) at one week (after tDCS completion), change from baseline (before tDCS, before 2nd menstrual phase) at four weeks (before the 3rd menstrual phase)

---

Secondary Outcomes

Description: To assess the threshold of thermal sensation (cold, cold-pain, heat, heat-pain; from 0 to 50 centigrade temperature), according to the established protocol of an ascending limit approach for heat pain and a descending limit approach for cold pain.

Measure: Quantitative sensory testing (QST)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess anxious symptoms; from 20 to 80; score 20: not anxious, score 80: extremely anxious

Measure: Spielberger State-Trait Anxiety Inventory (STAI)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess anxious symptoms; from 0 to 63; score 0: not anxious, score 63: extremely anxious

Measure: Beck Anxiety Inventory (BAI)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess depressive symptoms; from 0 to 63; score 0: not depressed, score 63: extremely depressed

Measure: Beck Depression Inventory (BDI)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess pain-maladaptive psychological status; from 0 to 52; score 0: not pain Catastrophizing , score 52: extremely pain Catastrophizing

Measure: Pain Catastrophizing Scale (PCS)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess pain status; from 0 to 78; score 0: not painful, score 78: extremely painful

Measure: Long-form McGill Pain Questionnaire (MPQ)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess quality of life; he SF-36 consists of eight scaled scores, which are the weighted sums of the questions in their section. Each scale is directly transformed into a 0-100 scale on the assumption that each question carries equal weight. From 0 to 100; score 0: equivalent to maximum disability, score 100: no disability.

Measure: Short-Form Health Survey (SF-36)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess testosterone, progesterone, estrogen

Measure: Blood Hormones Measurement

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase)

---

Description: To genotype the single nucleotide polymorphism genotyping (i.e., BDNF Val66Met polymorphism (rs6265), COMT Val158Met polymorphism (rs4680), OPRM1 (rs1799971), 5HTR2A (rs6313), SLC6A4 (rs25531)) from blood specimen

Measure: Genotyping

Time: baseline

---

Description: To assure blinding efficacy; Patients do self-assessment about whether they receive real tDCS or sham tDCS. Assessment questionnaire:1 or 0. 1: real tDCS; 0: sham tDCS.

Measure: Efficacy of tDCS blinding

Time: At 1 months after tDCS intervention

---

Primary Outcomes

Description: pain scale; from 0 to 10; score 0: no pain, score 10: unbearable pain

Measure: Visual Analog Scale (VAS)

Time: change from baseline (1st menstrual phase, before tDCS) at one month (2nd menstrual phase, with tDCS), change from baseline (1st menstrual phase, before tDCS) at two months (3rd menstrual phase)

---

Description: Somatosensory evoked magnetic fields (SEFs) is a well established magnetoencephalographic (MEG) cortical response evoked by electric stimulation. SEFs to experimental pain stimulation using electrical stimulator applied on the skin over the trajectory of median nerve will be used to evaluate pain-evoked cortical response.

Measure: Somatosensory evoked magnetic fields to experimental pain

Time: change from baseline (before tDCS, before 2nd menstrual phase) at one week (after tDCS completion), change from baseline (before tDCS, before 2nd menstrual phase) at four weeks (before the 3rd menstrual phase)

---

Secondary Outcomes

Description: To assess the threshold of thermal sensation (cold, cold-pain, heat, heat-pain; from 0 to 50 centigrade temperature), according to the established protocol of an ascending limit approach for heat pain and a descending limit approach for cold pain.

Measure: Quantitative sensory testing (QST)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess anxious symptoms; from 20 to 80; score 20: not anxious, score 80: extremely anxious

Measure: Spielberger State-Trait Anxiety Inventory (STAI)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess anxious symptoms; from 0 to 63; score 0: not anxious, score 63: extremely anxious

Measure: Beck Anxiety Inventory (BAI)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess depressive symptoms; from 0 to 63; score 0: not depressed, score 63: extremely depressed

Measure: Beck Depression Inventory (BDI)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess pain-maladaptive psychological status; from 0 to 52; score 0: not pain Catastrophizing , score 52: extremely pain Catastrophizing

Measure: Pain Catastrophizing Scale (PCS)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess pain status; from 0 to 78; score 0: not painful, score 78: extremely painful

Measure: Long-form McGill Pain Questionnaire (MPQ)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess quality of life; he SF-36 consists of eight scaled scores, which are the weighted sums of the questions in their section. Each scale is directly transformed into a 0-100 scale on the assumption that each question carries equal weight. From 0 to 100; score 0: equivalent to maximum disability, score 100: no disability.

Measure: Short-Form Health Survey (SF-36)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess testosterone, progesterone, estrogen

Measure: Blood Hormones Measurement

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase)

---

Description: To genotype the single nucleotide polymorphism genotyping (i.e., BDNF Val66Met polymorphism (rs6265), COMT Val158Met polymorphism (rs4680), OPRM1 (rs1799971), 5HTR2A (rs6313), SLC6A4 (rs25531)) from blood specimen

Measure: Genotyping

Time: baseline

---

Description: To assure blinding efficacy; Patients do self-assessment about whether they receive real tDCS or sham tDCS. Assessment questionnaire:1 or 0. 1: real tDCS; 0: sham tDCS.

Measure: Efficacy of tDCS blinding

Time: At 1 months after tDCS intervention

---

Primary Outcomes

Description: Edinburgh Postnatal Depression Scale. Score range: 0-30. Higher scores indicate more symptoms of postpartum depression. Total group

Measure: Depressive symptoms

Time: Week 3-6 postpartum

---

Description: Score on the Hamilton 17-item depression scale. Score range: 0-52. Higher scores indicate more depressive symptoms. Assessed in imaging group

Measure: Depressive symptoms

Time: Week 3-6 postpartum

---

Description: 116 a priori defined gene transcripts, which where differentially expressed in third trimester of women who later developed perinatal depression with postpartum onset relative to pregnant women who did not and to other depressed (reference Mehta et al, 2014, Psychological Medicine) and confirmed to be coupled to estrogen fluctuations (Mehtaet al. 2018 British Journal of Psychiatry) will be evaluated in the total group. Also DNA methylation of the genes of these transcripts will be determined and analysed in terms of their predictive value (above chance) for perinatal depression.

Measure: Gene transcript and DNA methylation markers of estrogen sensitivity

Time: Prior to caesarean section

---

Description: Latent variable construct of brain 5-HT4R level based on quantification of 5-HT4R binding from 11C-SB207145 positron emission tomography in primary volumes of interest; neocortex, nucleus caudatus, putamen and hippocampus. Assessed in imaging group.

Measure: Cerebral serotonin 4 receptor binding postpartum

Time: Week 3-6 postpartum

---

Description: Assessed in total group

Measure: CSF levels of GABA

Time: On day of caesarean section

---

Description: Assessed in total group

Measure: CSF levels of serotonin metabolite (5-HIAA)

Time: On day of caesarean section

---

Description: Cortisol awakening response, area under the curve with respect to baseline from 0 to 60 minutes from awakening.

Measure: Cortisol awakening response

Time: Week 3-6 postpartum

---

Description: Provides an estimate of cortisol exposure up to 6 months prior to delivery, total group

Measure: Hair cortisol level mothers

Time: On day of caesarean section.

---

Description: Provides an estimate of fetal cortisol exposure, infants from total group

Measure: Hair cortisol level newborns

Time: Day 0-5 postpartum.

---

Description: Hippocampal brain volume (including hippocampus) from structural MRI, imaging group.

Measure: Hippocampal volumes

Time: Week 3-6 postpartum.

---

Description: fMRI (BOLD response) based assessment of brain activity in response to reward, relative to non-reward, stimuli. Assessed in imaging cohort

Measure: functional MRI response to reward

Time: Week 3-6 postpartum.

---

Description: rsfMRI based spontaneous co-fluctuations in low frequency BOLD signal, (functional connectivity). Assessed with rsfMRI scan in the resting state, i.e. non-goal oriented spontaneous thought and awake. Assessed in imaging group.

Measure: Resting state functional connectivity MRI

Time: Week 3-6 postpartum

---

Description: Change in epigenetic SERT status from late pregnancy to postpartum week 3-6.

Measure: Change in epigenetic SERT status

Time: From just before delivery to 3-6 weeks postpartum

---

Description: Composite measure of hsCRP, TNF-α, IL-6, IL-18 and IL-10 levels, total group

Measure: Concentration of inflammatory markers, i.e hsCRP and immunoactive cytokines, in peripheral blood

Time: At week 3-6

---

Description: fMRI (BOLD response) based assessment of brain activity to emotionally salient, relative to neutral, stimuli. Assessed in imaging cohort.

Measure: functional MRI response to emotional faces

Time: Week 3-6 postpartum.

---

Secondary Outcomes

Description: Score on the Hamilton 17-item depression scale. Score range: 0-52. Higher scores indicate more depressive symptoms. Assessed in imaging group

Measure: Depressive symptoms

Time: Day 3-5 postpartum

---

Description: Score on the Hamilton 17-item depression scale. Score range: 0-52. Higher scores indicate more depressive symptoms. Assessed in imaging group

Measure: Depressive symptoms

Time: Week 12 postpartum

---

Description: Edinburgh Postnatal Depression Scale. Score range: 0-30. Higher scores indicate more symptoms of postpartum depression. Assessed in total group

Measure: Depressive symptoms

Time: Day 3-5 postpartum

---

Description: Edinburgh Postnatal Depression Scale. Score range: 0-30. Higher scores indicate more symptoms of postpartum depression. Assessed in all

Measure: Depressive symptoms

Time: 6 months postpartum

---

Description: Assessed in total group

Measure: CSF levels of serotonin

Time: On day of caesarean section

---

Description: Assessed in total group

Measure: CSF levels of dopamine metabolites

Time: On day of caesarean section

---

Description: Assessed in total group

Measure: CSF levels of noradrenaline metabolites

Time: On day of caesarean section

---

Description: Composite measure of IFN-c, IFN-alfa TNF-alfa og IL-6, in total group

Measure: CSF levels of inflammatory markers

Time: On day of caesarean section

---

Description: Estradiol level in peripheral blood, total group

Measure: Estradiol level

Time: Prior to caesarean section.

---

Description: Estradiol level peripheral blood, total group

Measure: Estradiol level

Time: At week 3-6 postpartum.

---

Description: Estradiol change pre- to postpartum, peripheral blood total group

Measure: Change in estradiol level

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Progesterone level in peripheral blood

Measure: Progesterone level

Time: Prior to caesarean section.

---

Description: Progesterone level in peripheral blood

Measure: Progesterone level

Time: At week 3-6 postpartum.

---

Description: Progesterone change pre- to postpartum, peripheral blood total group

Measure: Change in progesterone level

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Allopregnanolone level in peripheral blood

Measure: Allopregnanolone level

Time: Prior to caesarean section.

---

Description: Allopregnanolone level in peripheral blood

Measure: Allopregnanolone level

Time: At week 3-6 postpartum.

---

Description: Change in allopregnanolone level in peripheral blood

Measure: Change in allopregnanolone level

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Cortisol change pre- to postpartum, peripheral blood total group

Measure: Change in cortisol level

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Cortisol awakening response, area under the curve with respect to baseline from 0 to 60 minutes from awakening.

Measure: Cortisol awakening response

Time: Week 12 postpartum

---

Description: Cortisol awakening response, area under the curve with respect to baseline from 0 to 60 minutes from awakening.

Measure: Cortisol awakening response

Time: Prior to caesarean section

---

Description: Change in cortisol awakening response, from caesarean section to 3-6 weeks postpartum.

Measure: Change in cortisol awakening response

Time: ´From baseline (caesarean section to week 3-6 postpartum)

---

Description: Methylation status for the SERT gene, total group

Measure: DNA methylation of the SERT gene

Time: Prior to caesarean section

---

Description: DNA Methylation status for the SERT gene, total group

Measure: DNA methylation of the SERT gene

Time: Week 3-6 postpartum

---

Description: Methylation status for the FK506-binding protein 51 (FKBP5) gene, total group

Measure: DNA methylation of the FK506-binding protein 51 (FKBP5) gene

Time: Prior to caesarean section.

---

Description: Methylation status for the FK506-binding protein 51 (FKBP5) gene, total group

Measure: DNA methylation of the FK506-binding protein 51 (FKBP5) gene

Time: Week 3-6 postpartum

---

Description: Change in methylation status for the FK506-binding protein 51 (FKBP5) gene from late pregnancy to postpartum week 3-6.

Measure: Change in DNA methylation of the FK506-binding protein 51 (FKBP5) gene

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Methylation status for the glucocorticoid receptor gene, total group

Measure: DNA methylation of the glucocorticoid receptor gene

Time: Prior to caesarean section.

---

Description: Methylation status for the glucocorticoid receptor gene, total group

Measure: DNA methylation of the glucocorticoid receptor gene

Time: Week 3-6 postpartum

---

Description: Change in methylation status for the glucocorticoid receptor gene from late pregnancy to postpartum week 3-6.

Measure: Change in DNA methylation of the glucocorticoid receptor gene

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Methylation status for the COMT gene, total group

Measure: DNA methylation of the COMT gene

Time: Prior to caesarean section.

---

Description: Methylation status for the COMT gene, total group

Measure: DNA methylation of the COMT gene

Time: Week 3-6 postpartum

---

Description: Change in methylation status for the COMT gene from just before delivery to 3-6 weeks postpartum

Measure: Change in DNA methylation of the COMT gene

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Methylation status for the MAO-A gene, total group

Measure: DNA methylation of the MAO-A gene

Time: Prior to caesarean section.

---

Description: Change in methylation status for the MAO-A gene, total group

Measure: Change in DNA methylation of the MAO-A gene

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Methylation status for the MAO-A gene, total group

Measure: DNA methylation of the MAO-A gene

Time: Week 3-6 postpartum

---

Description: Methylation status for the oxytocin receptor gene, total group

Measure: DNA methylation of the oxytocin receptor gene

Time: Prior to caesarean section.

---

Description: Methylation status for the oxytocin receptor gene, total group

Measure: DNA methylation of the oxytocin receptor gene

Time: Week 3-6 postpartum

---

Description: Change in methylation status for the oxytocin receptor gene, total group

Measure: Change in DNA methylation of the oxytocin receptor gene

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Methylation status for the oxytocin gene, total group

Measure: DNA methylation of the oxytocin gene

Time: Prior to caesarean section.

---

Description: Methylation status for the oxytocin gene, total group

Measure: DNA methylation of the oxytocin gene

Time: Week 3-6 postpartum

---

Description: Change methylation status for the oxytocin gene, total group

Measure: Change in DNA methylation of the oxytocin gene

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Composite measure of hsCRP, TNF-α, IL-6, IL-18 and IL-10 levels, total group

Measure: Systemic inflammation peripheral blood hsCRP and immunoactive cytokines

Time: Prior to caesarean section.

---

Description: Change in composite measure of hsCRP, TNF-α, IL-6, IL-18 and IL-10 levels, total group

Measure: Change in systemic inflammation peripheral blood hsCRP and immunoactive cytokines

Time: From baseline (caesarean section to week 3-6 postpartum

---

Description: Family History Assessment Module (OS-FHAM). Number of first degree relatives with a history of depressive episodes or bipolar disorder. Total group.

Measure: Self reported family history of mood disorders

Time: Day 3-5 postpartum or before

---

Description: Barratt Impulsiveness Scale (BIS-11), self-reported. Range: 30-120. Total group.

Measure: Self reported impulsiveness score

Time: Day 3-5 postpartum or before

---

Description: NEO-PI-R - Revised NEO Personality Inventory, self-reported. Participants may score 20-80 for each of the personality traits: openness, conscientiousness, extraversion, agreeableness, and neuroticism. The higher the score, the more prominent is the personality trait. Total group.

Measure: Self reported Neuroticism score from NEO personality questionnaire

Time: Day 3-5 postpartum or before

---

Description: Parental bonding instrument (PBI), both parents, self-reported. Total group.

Measure: Self reported parental bonding quality

Time: Day 3-5 postpartum or before

---

Description: Perceived Stress Scale (PSS), range 0-40, a score of 0 indicates no perceived stress. Total group.

Measure: Self-reported perceived stress

Time: Day 3-5 postpartum

---

Description: Perceived Stress Scale (PSS), range 0-40, a score of 0 indicates no perceived stress. Total group.

Measure: Self-reported perceived stress

Time: Week 3-6 postpartum

---

Description: Change in Perceived Stress Scale (PSS), range 0-40, a score of 0 indicates no perceived stress. Total group.

Measure: Change in self-reported perceived stress

Time: Change from day 3-5 to week 3-6 postpartum

---

Description: Snaith-Hamilton Pleasure Scale (SHAPS), range 0-14, a score of 0 indicates no self-reported anhedonia. Total group.

Measure: Self-reported anhedonia

Time: Day 3-5 postpartum

---

Description: Snaith-Hamilton Pleasure Scale (SHAPS), range 0-14, a score of 0 indicates no self-reported anhedonia. Total group.

Measure: Self-reported anhedonia

Time: Week 3-6 postpartum

---

Description: Change in Snaith-Hamilton Pleasure Scale (SHAPS) score, range 0-14, a score of 0 indicates no self-reported anhedonia. Total group.

Measure: Change in self-reported anhedonia

Time: Change from day 3-5 to week 3-6 postpartum

---

Description: Rumination Response Scale (RRS), range 22-88, a score of 22 indicates no ruminative symptoms. Total group.

Measure: Self-reported rumination

Time: Day 3-5 postpartum

---

Description: Rumination Response Scale (RRS), range 22-88, a score of 22 indicates no ruminative symptoms. Total group.

Measure: Self-reported rumination

Time: Week 3-6 postpartum

---

Description: Change in Rumination Response Scale (RRS) score, range 22-88, a score of 22 indicates no ruminative symptoms. Total group.

Measure: Change in elf-reported rumination

Time: Change from day 3-5 to week 3-6 postpartum

---

Description: Profile of Mood States (POMS), range 0-260, a score of 0 indicates no mood disturbance. Total group.

Measure: Self-reported mood

Time: Day 3-5 postpartum

---

Description: Profile of Mood States (POMS), range 0-260, a score of 0 indicates no mood disturbance. Total group.

Measure: Self-reported mood

Time: Week 3-6 postpartum

---

Description: Change in Profile of Mood States (POMS) score, range 0-260, a score of 0 indicates no mood disturbance. Total group.

Measure: Change in self-reported mood

Time: Change from day 3-5 to week 3-6 postpartum

---

Description: Pittsburgh Sleep Quality Index (PSQI), range 0-21, a score of 0 indicates a healthy sleep quality. Total group.

Measure: Self-reported sleep quality

Time: Day 3-5 postpartum

---

Description: Pittsburgh Sleep Quality Index (PSQI), range 0-21, a score of 0 indicates a healthy sleep quality. Total group.

Measure: Self-reported sleep quality

Time: Week 3-6 postpartum

---

Description: Change in Pittsburgh Sleep Quality Index (PSQI), range 0-21, a score of 0 indicates a healthy sleep quality. Total group.

Measure: Change in self-reported sleep quality

Time: Change from day 3-5 to week 3-6 postpartum

---

Description: Brief symptom Inventory-53 item (BSI-53), range 0-212, increasing score means worsening of symptoms.Total group.

Measure: Self-reported psychiatric symptoms

Time: Day 3-5 postpartum

---

Description: Brief symptom Inventory-53 item (BSI-53), range 0-212, increasing score means worsening of symptoms.Total group.

Measure: Self-reported psychiatric symptoms

Time: Week 3-6 postpartum

---

Description: Change in Brief symptom Inventory-53 item (BSI-53) score, range 0-212, increasing score means worsening of symptoms.Total group.

Measure: Change in self-reported psychiatric symptoms

Time: Change from day 3-5 to week 3-6 postpartum

---

Description: WHO-5 well-being index, range 0-100, low score means less well-being. Total group.

Measure: Self-reported well-being

Time: Day 3-5 postpartum

---

Description: WHO-5 well-being index, range 0-100, low score means less well-being. Total group.

Measure: Self-reported well-being

Time: Week 3-6 postpartum

---

Description: Change in WHO-5 well-being index, range 0-100, low score means less well-being. Total group.

Measure: Change in self-reported well-being

Time: Change from day 3-5 to week 3-6 postpartum

---

Description: State Trait Anxiety Inventory (STAI-AD-D), state and trait subscales each have a range of 20-80, 20 means no anxiety. Total group.

Measure: Self-reported anxiety

Time: Day 3-5 postpartum

---

Description: State Trait Anxiety Inventory (STAI-AD-D), state subscale range 20-80, 20 means no anxiety. Total group.

Measure: Self-reported anxiety

Time: Week 3-6 postpartum

---

Description: Change in State Trait Anxiety Inventory (STAI-AD-D) score, state subscale range 20-80, 20 means no anxiety. Total group.

Measure: Change in self-reported anxiety

Time: Change from day 3-5 to week 3-6 postpartum

---

Description: Obsessive-Compulsive Inventory (OCI) score, self-reported, range 0-72, higher scores indicate more symptoms. Total group.

Measure: Self-reported obsessive and compulsive symptoms

Time: Day 3-5

---

Description: Obsessive-Compulsive Inventory (OCI) score, self-reported, range 0-72, higher scores indicate more symptoms. Total group.

Measure: Self-reported obsessive and compulsive symptoms

Time: Week 3-6 postpartum

---

Description: Change in Obsessive-Compulsive Inventory (OCI) score, self-reported, range 0-72, higher scores indicate more symptoms. Total group.

Measure: Change in self-reported obsessive and compulsive symptoms

Time: Change from day 3-5 to week 3-6 postpartum

---

Description: Performance on Simple Reaction Time, in imaging cohort.

Measure: Performance on Simple Reaction Time

Time: Week 3-6 postpartum

---

Description: Gray matter brain volume prefrontal cortex and anterior cingulate cortex

Measure: Gray matter brain volume prefrontal cortex and anterior cingulate cortex

Time: At week 3-6 postpartum

---

Description: Composite measure of serotonin, tryptophan og tryptofan hydroxylase levels relative to 5-HIAA, in placenta sample. Infants from total group

Measure: Serotonergic turnover in placenta

Time: At delivery.

---

Description: 11-beta-hydroxysteroid dehydrogenase type 2 activity in placenta. Infants from total group

Measure: 11-beta-hydroxysteroid dehydrogenase type 2 activity in placenta

Time: At delivery

---

Description: Composite measure of methylation status for the FKBP5, glucocorticoid receptor, 11-beta hydroxysteroid dehydrogenase type 2 genes. Infants from total group

Measure: Methylation status of genes relevant for stress-hormone regulation in placenta

Time: At delivery

---

Description: Composite measure of the methylation status for monoamine oxidase, serotonin receptor and serotonin transporter genes. Infants from total group

Measure: Methylation status of genes related to serotonergic signaling in placenta

Time: At delivery

---

Description: Composite measure of methylation status and gene transcript profiles of Glucocorticoid receptor, FKBP5, oxytocin and oxytocin receptors, Brain-derived neurotrophic factor (BDNF) genes. Assessed in blood from umbilical cord blood sample from infants, total group.

Measure: Methylation status and gene transcript profiles of relevance for early brain development and stress regulation in newborn infants

Time: At delivery.

---

Other Outcomes

Description: val158met (rs4680) status, binary variable, i.e. "val/val, val/met" vs "met/met" variants

Measure: COMT-genotype (rs4680) variant, i.e met/met vs other polymorphisms

Time: Prior to caesarean section.

---

Description: BDNF val66met (rs6265) status, binary variable, i.e. "val/val" versus "met-carrier" status

Measure: BDNF genotype (rs6265) status, i.e. val/val versus met-carrier variants

Time: Prior to caesarean section.

---

Description: 5-HTTLPR genotype status (binary), i.e. high-expressing LALA vs low-expressing (S or LG) variants, based on SLC6A4, i.e. L or S variants, and further subtyping on rs25531 haplotype L(A)L(A) vs LGLA, LGLG or variants containing as S as specified above.

Measure: 5-HTT genotype status, i.e LALA vs low-expressing (S or LG) variants

Time: Prior to caesarean section.

---

Description: In house interview based on Kennerley Maternity Blues Questionnaire, range: 0-28, higher score indicates more severe postpartum blues symptoms. High blues score is associated with greater risk for perinatal depression at week 3-6.

Measure: Postpartum blues symptoms

Time: Day 3-5 postpartum.

---

Description: In house interview based on Stein's Maternity Blues Scale, range 0-26. High blues score is associated with greater risk for perinatal depression at week 3-6.

Measure: Postpartum blues symptoms

Time: Day 3-5 postpartum.

---

Primary Outcomes

Description: Assessment of atopic dermatitis severity is conducted using Scoring of Atopic Dermatitis (SCORAD) index. SCORAD index formula is: A/5 + 7B/2 + C. In this formula A is defined as the extent (0-100), B is defined as the intensity (0-18) and C is defined as the subjective symptoms (0-20). The maximum SCORAD score is 103. SCORAD <23 - mild AD; SCORAD from 23 to 63 - moderate AD; SCORAD> 63 - severe AD.

Measure: Assessment of change in the severity of atopic dermatitis after conventional treatment from study onset (baseline) at week 10

Time: At disease onset (study baseline) and at week 10

---

Description: Assessment of the psoriasis severity is conducted using Psoriasis Area and Severity Index (PASI). The patient's body is divided into four sections (head (H) (10% of a person's skin); arms (A) (20%); trunk (T) (30%); legs (L) (40%)). The percent of skin lesions of each area is assessed as follows: 0 (0% of involved area); 1 (< 10%); 2 (10-29%); 3 (30-49%); 4 (50-69%); 5 (70-89%); 6 (90-100%). Further, for each region, the intensity of 3 clinical signs is evaluated - redness, thickness and scaling and assessed as follows: 0 - no lesions,1 - easy, 2 - moderate, 3 - severe, 4 - very severe. The sum of all three severity parameters is calculated for each section, multiplied by the area score for that area and multiplied by weight of respective section (0.1 for head, 0.2 for arms, 0.3 for body, 0.4 for legs). PASI range is from 0 (no disease) to 72 (maximum disease). The severity of psoriasis is assessed as follows: PASI <20 - mild; PASI from 20 to 50 - moderate; PASI> 50 - severe

Measure: Assessment of change in the severity of psoriasis after conventional treatment from study onset (baseline) at week 10

Time: At disease onset (study baseline) and at week 10

---

Description: Depression is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Depression Rating Scale (HAM-D) using the following ranges: absence, ≤7; mild, 8-16; moderate, 17-27; severe, ≤28

Measure: Assessment of change in the severity of depression in atopic dermatitis and psoriasis patients after conventional treatment from study onset (baseline) at week 10

Time: At disease onset (study baseline) and week 10

---

Description: Depression is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Depression Rating Scale (HAM-D) using the following ranges: absence, ≤7; mild, 8-16; moderate, 17-27; severe, ≤28

Measure: Assessment of the severity of depression in healthy controls (HC)

Time: At disease onset (study baseline)

---

Description: Anxiety is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Anxiety Rating Scale (HAM-A) using the following ranges: ≤17, easy; 18-24, moderate; over 25, medium-severe

Measure: Assessment of change in the severity of anxiety in atopic dermatitis and psoriasis patients after conventional treatment from study onset (baseline) at week 10

Time: At disease onset (study baseline) and week 10

---

Description: Anxiety is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Anxiety Rating Scale (HAM-A) using the following ranges: ≤17, easy; 18-24, moderate; over 25, medium-severe

Measure: Assessment of the severity of anxiety in HC

Time: At disease onset (study baseline)

---

Description: The total IgE levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 0.000-100.0 IU/ml

Measure: Evaluation of changes in serum immunoglobulin E (IgE, IU/ml) levels from study onset (baseline) at week 10 in atopic dermatitis patients

Time: At disease onset (study baseline) and week 10

---

Description: The total IgE levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 0.000-100.0 IU/ml

Measure: Analysis of serum IgE (IU/ml) levels in HC

Time: At disease onset (study baseline)

---

Description: Serum BDNF levels are analyzed using a solid-phase, sandwich, two-site, ELISA (Promega, US; G7610). No measurement scale is used

Measure: Evaluation of changes in serum Brain Derived Neurotrophic Factor (BDNF, ng/ml) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients

Time: At disease onset (study baseline) and week 10

---

Description: Serum BDNF levels are analyzed using a solid-phase, sandwich, two-site, ELISA (Promega, US; G7610). No measurement scale is used

Measure: Analysis of serum BDNF (ng/ml) levels in HC

Time: At disease onset (study baseline)

---

Description: The total cortisol levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 138-690 nmol/L

Measure: Evaluation of changes in cortisol (nmol/L) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients

Time: At disease onset (study baseline) and week 10

---

Description: The total cortisol levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 138-690 nmol/L

Measure: Analysis of serum cortisol (nmol/L) levels in HC

Time: At disease onset (study baseline)

---

Description: The total testosterone levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: men 20-49 years - 72 -853ng/dL; men≥50 years -129-767 ng/dL; women ovulating - 0.010-73.0 ng/dL; women postmenopausal - 0.010-43.0 ng/dL.

Measure: Evaluation of changes in testosterone (ng/dL) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients

Time: At disease onset (study baseline) and week 10

---

Description: The total testosterone levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: men 20-49 years - 72 -853ng/dL; men≥50 years -129-767 ng/dL; women ovulating - 0.010-73.0 ng/dL; women postmenopausal - 0.010-43.0 ng/dL.

Measure: Analysis of serum testosterone (ng/dL) levels in HC

Time: At disease onset (study baseline)

---

Description: DNA extraction and genotyping the BDNF rs6265 (Val66Met) gene polymorphism in AD, PS and HC

Measure: DNA extraction in AD, PS and HC

Time: At disease onset (study baseline)

---

Secondary Outcomes

Description: EAD and IAD patients will be divided into subgroups in accordance with BDNF gene polymorphism and gender with following assessment of SCORAD scores compared with baseline after conventional treatment at week 10 in each group using unpaired t-test

Measure: Assessment and comparison (Unpaired t-test) of SCORAD scores in extrinsic atopic dermatitis (EAD, IgE level above the normal) and intrinsic atopic dermatitis (IAD, normal IgE level) patients compared with baseline after conventional treatment at week 10

Time: At disease onset (study baseline) and week 10

---

Description: Psoriasis patients will be divided into subgroups in accordance with BDNF gene polymorphism and gender with following assessment of PASI scores compared with baseline after conventional treatment at week 10 in each group.

Measure: Assessment and comparison (Unpaired t-test) of PASI scores in psoriasis patients compared with baseline after conventional treatment at week 10 in accordance with BDNF gene polymorphism (Val/Val; Val/Met;Met/Met) and gender(males, females)

Time: At disease onset (study baseline) and week 10

---

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of HAM-D scores in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of HAM-D scores in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of HAM-D scores in EAD, IAD, PS and HC

Time: At disease onset (study baseline) and week 10

---

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of HAM-A scores in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of HAM-A scores in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of HAM-A scores in EAD, IAD,PS and HC

Time: At disease onset (study baseline) and week 10

---

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of serum BDNF(ng/ml) levels in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of serum BDNF levels in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of serum BDNF (ng/ml) levels in EAD, IAD,PS and HC

Time: At disease onset (study baseline) and at week 10

---

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for comparisons of serum cortisol (nmol/L) levels in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of serum cortisol levels in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of serum cortisol (nmol/L) levels in EAD, IAD,PS and HC

Time: At disease onset (study baseline) and at week 10

---

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of serum testosterone (ng/dL) levels in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of serum testosterone levels in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of serum testosterone (ng/dL) levels in EAD, IAD,PS and HC

Time: At disease onset (study baseline) and at week 10

---

Description: Assessment of testosterone/cortisol ratio in EAD, IAD, PS patients and HC divided into BDNF rs6265 gene polymorphism (Val/Val; Val/Met; Met/Met) and gender (males, females) at study baseline and week 10

Measure: Assessment of testosterone/cortisol ratio in EAD, IAD, PS patients and HC in accordance with BDNF rs6265 gene polymorphism and gender

Time: At disease onset (study baseline) and at week 10

---

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of testosterone/cortisol ratio in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of testosterone/cortisol ratio in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of testosterone/cortisol ratio in EAD, IAD, PS and HC

Time: At disease onset (study baseline) and at week 10

---

Description: Correlation analysis of dermatological, psychological and biochemical parameters in EAD, IAD and PS patients, and HC divided into groups in accordance with BDNF rs6265 gene polymorphism (Val/Val; Val/Met; Met/Met) and gender (males, femaes)

Measure: Correlation analysis of studied parameters in dermatological patients and HC

Time: At disease onset (study baseline) and week 10

---

Primary Outcomes

Description: Change from before and after the First phase of treatment on Pain scores assessed by a visual analogue scale (VAS 0 to 100mm) (0 means no pain - 100 means the worst pain imaginable)

Measure: Change in pain level - first phase

Time: 1 month

---

Description: Change from before and after the First phase of treatment on Total score on the Brazilian Profile of Chronic Pain: Screen (BPCP:S) (range from 0 to 93; high numbers means more pain severity, interference in daily activities and emotional burden)

Measure: Change in functional capacity - first phase

Time: 1 month

---

Secondary Outcomes

Description: Change from before and after the Second phase of treatment on Pain scores assessed by a visual analogue scale (VAS 0 to 100mm) (0 means no pain - 100 means the worst pain imaginable)

Measure: Change in pain level - second phase

Time: 3 months

---

Description: Change from before and after the First phase of treatment on Total score on the Brazilian Profile of Chronic Pain: Screen (BPCP:S) (range from 0 to 93; high numbers means more pain severity, interference in daily activities and emotional burden)

Measure: Change in functional capacity - second phase

Time: 3 months

---

Description: Change from before and after the First phase of treatment on the score in a numerical pain scale (NPS 0-10) for a moderate heat pain stimulus to the right arm (ventral region) during a conditioned pain modulation task (CPM-task), where participant keeps the counter-lateral hand in an iced cold water (0 to 1º Celsius)

Measure: Change in Function of modulatory descending system

Time: 1 month

---

Description: Change from before and after the First phase of treatment on measures of motor threshold (MT), motor evoked potential (MEP), intracortical facilitation (ICF), short intracortical inhibition (SICI), and cortical silent period (CSP) assessed with transcranial magnetic stimulation (TMS).

Measure: Change in Function of corticospinal pathway

Time: 1 month

---

Description: Blood samples will be collected at baseline and after the First phase of intervention in order to determine BDNF serum levels using a standardized kit

Measure: Change in levels of Brain derived neurotrophic factor - BDNF

Time: 1 month

---

Description: Blood samples will be collected at baseline in order to determine BDNF gene polymorphism for the G allele (rs6265)

Measure: Polymorphism of Brain derived neurotrophic factor - BDNF

Time: 10 minutes

---

Primary Outcomes

Description: Global swallowing function is rated from videofluoroscopy swallowing studies (VFSS), using the Dynamic Imaging Grade of Swallowing Toxicity (DIGEST), a validated 5-point scale. Global swallowing function is rated from 0-4: 0 = no pharyngeal dysphagia; 1 = mild; 2 = moderate; 3 = severe; 4 = life-threatening. A lower score is a better outcome.

Measure: Global Swallowing Function

Time: Change in score from week 0 to week 5

---

Secondary Outcomes

Description: Global swallowing function is rated from videofluoroscopy swallowing studies (VFSS), using the Dynamic Imaging Grade of Swallowing Toxicity (DIGEST), a validated 5-point scale. Global swallowing function is rated from 0-4: 0 = no pharyngeal dysphagia; 1 = mild; 2 = moderate; 3 = severe; 4 = life-threatening.

Measure: Global Swallowing Function

Time: Change in score from week 0 to week 15; change in score from week 5 to week 15.

---

Description: MEP is a measure of respiratory muscle strength and is assessed with a handheld manometer, measured in centimetres of water (cmH2O). A higher score is a better outcome.

Measure: Maximum expiratory pressure (MEP)

Time: Change in score from week 0 to week 5; change in score from week 0 to week 15; change in score from week 5 to week 15.

---

Description: Measure of cough strength that is assessed using a spirometer, measured in litres per minute (L/min). A higher score is a better outcome.

Measure: Volitional cough strength (peak cough flow)

Time: Change in score from week 0 to week 5; change in score from week 0 to week 15; change in score from week 5 to week 15.

---

Description: Measure of how much air is exhaled during forced exhalation and is assessed with a spirometer, measured in litres. A higher score is a better outcome.

Measure: Forced vital capacity (FVC)

Time: Change in score from week 0 to week 5; change in score from week 0 to week 15; change in score from week 5 to week 15.

---

Description: A measure daily nutritional and hydration consumption. Oral intake is assessed using the Functional Oral Intake Scale (FOIS), a validated 7-point ordinal scale (1 = no oral intake; 2 = tube dependent with minimal/inconsistent oral intake; 3 = tube supplements with consistent oral intake; 4 = total oral intake in single consistency; 5 = total oral intake of multiple consistencies requiring special preparation; 6 = total oral intake with no special preparation, but must avoid specific foods or liquid items; 7 = total oral intake with no restrictions). A higher score is a better outcome.

Measure: Oral Intake

Time: Change in score from week 0 to week 5; change in score from week 0 to week 15; change in score from week 5 to week 15.

---

Description: Will be measured using the Eating Assessment Tool-10 (EAT-10), a self-administered, symptom-specific outcome instrument for dysphagia. The EAT-10 allows patients to rate their swallowing symptoms on scale of 0 = no problem to 4 = severe problem. A lower score is a better outcome.

Measure: Self-perceived swallowing impairment

Time: Change in score from week 0 to week 5; change in score from week 0 to week 15; change in score from week 5 to week 15.

---

Description: An optional blood sample will be collected for biomarker analysis, to identify correlations with clinical response. We will measure genetic biomarkers associated with swallowing function including rs6265, rs165599, rs10835211, rs17601696, and APOE4 genotype status. For these 5 genetic biomarkers, participants will be scored as having zero, one, or two alleles. This information will be used in subgroup analyses for the primary and secondary outcomes.

Measure: Biomarker analyses

Time: Baseline measurement (week 0)

---

Primary Outcomes

Description: BDNF rs6265 polymorphism will be analyzed using HpyCH4IV restriction enzyme which identifies homozygous Valine/Valine, heterozygous Valine/Methionine and homozygous Methionine/Methionine

Measure: Presence/absence of rs6265 in the BDNF

Time: Baseline (T0)

---

Description: SLC6A4 5-HTTLPR polymorphism will be analyzed by a specific protocol that identifies gene polymorphisms according to the polymerase chain reaction (PCR) fragment sizes: short [S; 486 base pairs (bp), 14 repeats], long [L; 529bp, 16 repeats], or extra-long [XL; 612 or 654bp, 20 or 22 repeats].

Measure: Presence/absence of 5-HTTLPR in the SLC6A4

Time: Baseline (T0)

---

Secondary Outcomes

Description: Promoter methylation of BDNF using pyrosequencing analysis with PyroMark Q24 (Qiagen, Germany).

Measure: Change in promoter methylation levels of BDNF gene

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

---

Description: Promoter methylation of SLC6A4 using pyrosequencing analysis with PyroMark Q24 (Qiagen, Germany).

Measure: Change in promoter methylation levels of SLC6A4 gene

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

---

Other Outcomes

Description: The FMA-UL is a stroke-specific, performance-based impairment index. It is designed to assess motor functioning, sensation and joint functioning in patients with post-stroke hemiplegia. The upper limb portion of the FMA-UL ranges from 0 (hemiplegia) to 66 points (normal upper limb motor performance).

Measure: Change in Fugl-Meyer Assessment of Motor Recovery after Stroke for Upper Extremity portion (FMA-UL)

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

---

Description: The BI is designed to assess the ability of an individual with a neuromuscular or musculoskeletal disorder to care for him/herself. It ranges from 0 to 100, with a higher number meaning better performance in activities of daily living.

Measure: Change in Modified Barthel Index (BI)

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

---

Description: The Motricity Index is used to measure strength in upper extremities and ranges from 0 to 100, with higher scores meaning higher strength.

Measure: Change in Motricity Index (MI)

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

---

Description: SDMT evaluates information processing speed. It consists of a simple task of replacing symbols with numbers. Using a reference key, the patient has 90 seconds to match a sequence of symbols with the correspondent numbers as rapidly as possible. Both written or oral administration can be used.

Measure: Change in Symbol Digit Modalities Test (SDMT)

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

---

Description: The TOL test is a tool to assess strategic decision and problem solving. The patient is required to move different colored balls on the three pegs of different lengths, according to a model and a number of established moves. The maximum time for each configuration is 60 seconds.

Measure: Tower of London (TOL)

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

---

Description: The ROCF is a neuropsychological assessment for evaluation of visuospatial abilities, memory, attention, planning, working memory and executive functions. The patient is required to copy a complex figure freehand (recognition), and then draw it from memory (recall). The score is assigned based on the correctness of each line (from 0 to 2).

Measure: Change in Rey-Osterrieth Complex Figure Test (ROCF).

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

---

Description: The DS is a test that measures the verbal memory span (digit memory). The patient is required to correctly repeat the sequence of number listened. It is composed by two different tests: the Digits Forward and the Digit Backward. The range for Digit Forward is from 6 to -1.

Measure: Change in Digit Span (DS)

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

---

Description: The SCWT is a neuropsychological test used to assess the cognitive interference. The patient is required to read three different tables as fast as possible (in 30 seconds): the first contains 100 names of colors ink in black; the second contains 100 shapes of different colors (red, blue, green); the third contains 100 color-words are printed in an inconsistent color ink (for instance the word "red" is printed in green ink).

Measure: Change in Stroop and Color Word test (SCWT)

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

---

Description: The BBT is a tool to measure unilateral gross manual dexterity. Patients are seated at a table, in front of a rectangular box with a partition in the middle. 150 colored, wooden blocks are placed in one compartment. Patients are required to move as many blocks as possible, one at time, from one compartment to the other in a period of 60 seconds. BBT is scored by counting the number of blocks carried over from a compartment to the other one. At the beginning, patients perform a one-minute trial period. Patients have to perform the BBT with both hands.

Measure: Change in Box and Block test (BBT)

Time: Baseline [T0], First Treatment (6 weeks and 30 rehabilitation session) [T1], Second treatment (other 6 weeks and other 30 rehabilitation session) [T2]

---

Primary Outcomes

Description: The MADRS contains 10 items, and each item is scored 0-6. These item scores are summed to create a scale score; thus, scale scores range from 0 to 60. A scale score of 0 indicates the absence of depressive symptoms, while a score of 60 indicates severe depression. The primary outcome is the mean change in total MADRS score. A decrease in the mean MADRS score indicates a decrease (or improvement) in depressive symptoms, whereas an increase in the mean MADRS score indicates an increase (or worsening) in depressive symptoms.

Measure: Montgomery-Åsberg Depression Rating Scale (MADRS) Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Secondary Outcomes

Description: The CGI is a clinician-measured scale of 3 items: Severity of Illness (item 1), Global Improvement (item 2), and Efficacy Index (item 3). Items 1 and 2 are rated on a 7-point Likert scale (1=normal, 7=among the most extremely ill patients) with a possible response of "not assessed." Item 3 is rated on a 4-point Likert scale from "none" to "outweighs therapeutic effect." Items 1 and 3 are assessed in relation to last clinical encounter (if possible).

Measure: Clinical Global Impression/Severity (CGI) Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The GAD-7 is the self-reported anxiety questionnaire which scores each of the 7 symptoms of Generalized Anxiety Disorder in the last two weeks on a 4-point scale, i.e. 0 ("not at all"), 1 ("several days"), 2 ("over half the days") and 3 ("nearly every day"). Functional impairment is also assessed from "Not difficult at all" to "Extremely difficult."

Measure: Generalized Anxiety Disorder, 7-item (GAD-7) Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The MoCA is a 30-point screening instrument for detecting cognitive dysfunction. It is used to assess the following cognitive domains: visuospatial/executive, naming, memory, attention, language, abstraction, delayed (short-term memory recall), and orientation.

Measure: Montreal Cognitive Assessment (MoCA) Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The PHQ-9 is the self-reported depression module of the PHQ, which scores each of the 9 symptoms of a major depressive episode on a 4-point scale, i.e. 0 ("not at all"), 1 ("several days"), 2 ("more than half the days") and 3 ("nearly every day"). Functional impairment is also assessed from "Not difficult at all" to "Extremely difficult."

Measure: Patient Health Questionnaire, 9-item (PHQ-9) Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The TCI is a 240-item questionnaire. It operates with seven dimensions of personality traits, i.e. four so-called temperaments: Novelty Seeking (NS), Harm Avoidance (HA), Reward Dependence (RD), and Persistence (PS), and three so-called characters: Self-Directedness (SD), Cooperativeness (CO) and Self-Transcendence (ST). Each of these traits has a varying number of subscales.

Measure: Temperament and Character Inventory (TCI) Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Other Outcomes

Description: The patient will be asked to continuously wear a Fitbit wristband to monitor gross motor activity, e.g. foot steps. Changes in gross motor activity throughout the day will also provide data on circadian rhythmicity (sleep-wake cycles).

Measure: Actigraphy Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The investigators will obtain tissue samples, e.g. blood, saliva, and/or cheek swabs, and DNA will be isolated and extracted. Data on genetic polymorphisms (differences) that have been demonstrated or hypothesized to play a functional role in major depression, e.g. the brain derived neurotrophic factor (BDNF) rs6265 (val66met) single nucleotide polymorphism, will be obtained. These genotypes (genetic data) will then be correlated with antidepressant response.

Measure: Candidate Gene (DNA) Polymorphisms

Time: The genetic specimen will be obtained within approximately 1 week of starting treatment (likely with the baseline epigenetic sample.

---

Description: The investigators will obtain task-free ("resting state") rs-EEG [detecting electrical signals in the brain] at baseline and in response to interventional treatments for treatment-resistant depression.

Measure: Electroencephalography (EEG) Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The investigators will obtain tissue samples, e.g. blood, saliva, and/or cheek swabs, at baseline and in response to interventional treatments for treatment-resistant depression. DNA will be isolated and extracted. Data on epigenetic (experience-based) modifications to the DNA that have been demonstrated or hypothesized to play a functional role in major depression, e.g. global methylation changes, will be obtained. Changes in epigenetic status, e.g. global DNA methylation changes pre- and post-treatment, will then be correlated with antidepressant response.

Measure: Epigenetic (Experience-Based) DNA Modifications Pre-Post Change

Time: The initial specimen will be obtained within approximately 1 week of starting treatment. The post-specimen will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: Facial recognition software, FaceX (FaceX LLC) will be used to record and analysis facial features at rest and evoked by interview questions and emotionally provocative videos.

Measure: Facial Expression Analysis Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: Galvanic skin response as a surrogate marker of autonomic reactivity will be obtained in response to the presentation of emotional stories or images.

Measure: Galvanic Skin Response Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: Heart rate variability as a surrogate marker of autonomic reactivity will be obtained in response to the presentation of emotional stories or images.

Measure: Heart Rate Variability Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The NIH Toolbox is a comprehensive set of neurobehavioral assessments that assess multiple neuropsychiatric domains. We will perform the cognitive and emotional batteries in this study.

Measure: National Institutes of Health (NIH) Toolbox(R) Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: Pupillometry (pupil diameter measurements) as a surrogate marker of autonomic reactivity will be obtained in response to the presentation of emotional stories or images.

Measure: Pupillometry Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The investigators will obtain task-free ("resting state") rs-fMRI [detecting blood oxygen-level dependent (BOLD) signal in the brain] at baseline and in response to interventional treatments for treatment-resistant depression.

Measure: Resting State Functional Magnetic Resonance Imaging (rs-fMRI) Pre-Post Change

Time: The initial imaging session will be obtained within approximately 1 week of starting treatment. The post-treatment imaging session occur as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The investigators will obtain structural brain imaging at baseline and in response to interventional treatments for treatment-resistant depression.

Measure: Structural Magnetic Resonance Imaging (MRI) Pre-Post Change

Time: The initial imaging session will be obtained within approximately 1 week of starting treatment. The post-treatment imaging session occur as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The patient will be asked to read standardized passages, i.e. Grandfather Passage and Rainbow Passage, and answer questions about daily life and interests while being recorded. These recordings will be transcribed and analyzed for vocal tone, inflection, word choice, etc.

Measure: Vocal Pattern Detection Pre, During and Post-Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Interim assessments will occur weekly during treatment. Post-assessment will be obtained as close as possible following completion of treatment course.

---

Primary Outcomes

Description: Performances on the computerized cognitive test of Multi-Source Interference Task will be examined in terms of speed and accuracy. Participants are instructed to identify the target number, which is different than the other 3 numbers provided on the computer screen. There are two types of trials, congruent and incongruent. Congruent trials have a target number that is always matched its position on the button (e.g., 100, 020, or 223), in contrast, incongruent trials have the target number that is never matched with it position in the button (e.g., 010, 233, or 232). Faster response time and lower error rates indicate better attention.

Measure: Changes in attention - Multi-Source Interference Task

Time: Baseline, 4 weeks, 8 weeks, and 26 weeks

---

Description: Participants are instructed to remember the sequence of numbers the data collector told and repeat the numbers right after the instructor finished talking. This test has 2 subsets, Forward-repeat exactly the same sequence, and Backward-repeat the numbers in the backward from last to the first. More digits correctly repeated indicate better attention.

Measure: Changes in attention - Digit Span Test

Time: Baseline, 4 weeks, 8 weeks, and 26 weeks

---

Description: This traditional cognitive test of attention is a paper-pencil based measure and has 2 parts. Part A requires participants to connect a series of randomly arrayed, distinct circles numbered 1 to 25 in correct order as quickly as possible. Part B requires participants to connect a series of 25 circles numbered 1 to 13 randomly intermixed with letters from A to L, alternating between numbers and letters, and proceeding in ascending order (e.g., 1-A-2-B-3 and so on). Faster response time in seconds indicates better attention.

Measure: Changes in attention - Trail Making Test

Time: Baseline, 4 weeks, 8 weeks, and 26 weeks

---

Description: Stroop Test is a color-word test measuring the ability to processe different visual features and ignore distractions. The test has 2 parts of reading letters of color names and colors of color names using 4 color names (i.e., red, blue, yellow, and green). Congruent trials have the same letters and colors of the color names (i.e., red in red color). Incongruent trials have different letters and colors of the color names (i.e., red in blue color). Faster response time and lower error rates indicate better attention.

Measure: Changes in attention - Stroop Test

Time: Baseline, 4 weeks, 8 weeks, and 26 weeks

---

Description: This self-reported questionnaire has 13 items on 0 to 10 response scales asking effectiveness in behaviors requiring attention. Higher scores indicate better subjective attention

Measure: Changes in attention - Attentional Function Index

Time: Baseline, 4 weeks, 8 weeks, and 26 weeks

---

Secondary Outcomes

Description: This self-reported questionnaire consists of 29 items divided into 3 scales measuring self-care maintenance, symptom perception, and self-care management. In addition, self-care confidence is measured by additional 10 items. Each scale is scored separately and standardized to achieve a possible score of 0 to 100. Higher scores indicate better self-care of HF.

Measure: Changes in the Self-Care of Heart Failure Index (SCHFI)

Time: Baseline, 4 weeks, 8 weeks, and 26 weeks

---

Description: Minnesota Living with Heart Failure Questionnaire will be used to measure health-related quality of life. This self-report questionnaire consists of 21 items on which patients are asked to rate how their HF condition impacted their physical and emotional health. Lower scores indicate better HRQL.

Measure: Changes in Minnesota Living with Heart Failure Questionnaire (LHFQ)

Time: Baseline, 4 weeks, 8 weeks, and 26 weeks

---

Other Outcomes

Description: Venipuncture will be performed to draw the blood by following Indiana University general laboratory safety guidelines. Changes in the serum BDNF levels (ng/ml) and its associations with attention will be examined.

Measure: Changes in serum brain-derived neurotrophic factor levels (serum BDNF)

Time: Baseline and 4 weeks

---

Description: Venupucture will be performed to draw the blood for the possible genetic biomarker. The frequency of BDNF Val66Met genotype (e.g., rs6265) will be examined and attention will be examined by the genotype.

Measure: BDNF gene

Time: Baseline

---

Description: Venupucture will be performed to draw the blood for the possible genetic biomarker. The 3 common allele of APOE (i.e., e2, e3, and e4) will be examined. The frequency of APOE genotypes (e.g., rs7412, rs429358) will be examined and attention will be examined by the genotype.

Measure: Apolipoprotein (APOE) gene

Time: Baseline

---

Description: Venupucture will be performed to draw the blood for the possible genetic biomarker. Specifically, dopamine receptor gene 4 (e.g., 48 bp VNTR) polymorphism and its association with attention will be examined.

Measure: Dopamine receptor gene

Time: Baseline

---

Description: Venupucture will be performed to draw the blood for the possible genetic biomarker. The dopamine transporter gene (DAT1) (e.g., rs28363170 - 40 bp VNTR) polymorphism and its association with attention will be examined.

Measure: Dopamine transporter gene

Time: Baseline

---