Unexplained polycythemias are rare diseases, and therefore, the collection of data inherent to these diseases will not only improve their characterisation, but also allow stratification according to the risks and the course of the disease. The objective of this project is to constitute a database on the disease which will allow us to better understand it and in due course improve its management. The GENRED project thus bears uniquely on the collection of information, which will be gathered throughout the usual management of patients for this type of disease.

NCT03263364

Conditions

1. Hereditary Erythrocytosis/Idiopathic Erythrocytosis

MeSH:Polycythemia

HPO:Polycythemia

The required tests are: complete blood counts - Blood electrolytes - Arterial and venous gazes - Serum erythropoietin dosage - Liver function tests - JAK2 mutations (both V617F and exon 12) - Bone marrow aspirate and/or biopsy and/or endogenous BFU-E culture - Abdominal ultrasound - Lung function tests Inclusion Criteria: The characteristics of the patients included in the database will be described in terms of numbers and percentages for qualitative variables and in terms of means and standard deviations or medians and interquartile intervals for quantitative variables. --- V617F ---

The required tests are: complete blood counts - Blood electrolytes - Arterial and venous gazes - Serum erythropoietin dosage - Liver function tests - JAK2 mutations (both V617F and exon 12) - Bone marrow aspirate and/or biopsy and/or endogenous BFU-E culture - Abdominal ultrasound - Lung function tests Hereditary Erythrocytosis/Idiopathic Erythrocytosis Polycythemia null --- V617F ---

This study will assess the safety and efficacy of Panobinostat as a single agent in the treatment of Primary Myelofibrosis, Post-Polycythemia Vera and Post-Essential Thrombocythemia. There will be two cohorts - patients with JAK2 mutation and patients without JAK2 mutation.

NCT00931762

Conditions

1. Primary Myelofibrosis
2. Post-Polycythemia Vera
3. Post-Essential Thrombocytopenia

Interventions

1. Drug: Panobinostat

MeSH:Polycythemia Vera Primary Myelofibrosis Thrombocytopenia Polycythemia

HPO:Polycythemia Thrombocytopenia

To compare the response to panobinostat in patients with the JAK2 V617F mutation to those without the JAK2 V617F mutation. --- V617F ---

To compare the response to panobinostat in patients with the JAK2 V617F mutation to those without the JAK2 V617F mutation. --- V617F --- --- V617F ---

(The presence of a JAK2 V617F mutation is not required for study entry) 2. Patients must meet the following laboratory criteria: - Patients can be either JAK2 V617F mutated or wild type - Serum potassium, magnesium, phosphorous, sodium, total calcium (corrected for serum albumin) or ionized calcium within normal limits (WNL) for the institution Note: Potassium, magnesium, phosphorous, sodium, and/or calcium supplements maybe given to correct values that are < LLN. --- V617F ---

(The presence of a JAK2 V617F mutation is not required for study entry) 2. Patients must meet the following laboratory criteria: - Patients can be either JAK2 V617F mutated or wild type - Serum potassium, magnesium, phosphorous, sodium, total calcium (corrected for serum albumin) or ionized calcium within normal limits (WNL) for the institution Note: Potassium, magnesium, phosphorous, sodium, and/or calcium supplements maybe given to correct values that are < LLN. --- V617F --- --- V617F ---

The main goal of the study is to progress in our understanding of the molecular basis of myeloproliferative disorders of the bone marrow (polycythemia vera, essential thrombocythemia, primary myelofibrosis). The study will focus on the genes encoding factors implicated in the JAK-STAT pathway which has an essential role in these diseases

NCT00873574

Conditions

1. Myeloproliferative Disorders

Interventions

1. Biological: Blood samples and buccal swabs

MeSH:Myeloproliferative Disorders Disease

HPO:Myeloproliferative disorder

The recent identification of a recurrent activating tyrosine kinase mutation V617F in the JAK2 gene provides a breakthrough in the understanding of the molecular mechanisms of these diseases. --- V617F ---

The investigators have shown actually that the mutation V617F is a somatic one which is variably expressed among patients in the same family.Other somatic mutations and inherited factors, still unknown, may explain these discrepancies. --- V617F ---

JAK-STAT pathway has an essential role in non-CML MPD as was shown by the functional consequences of the V617F JAK2 mutation. --- V617F ---

The primary objective of this study is to evaluate plasmatic concentrations of free PGF and sFlt1 for blood samples taken before a first low-molecular-weight-heparin injection and also for blood samples taken on the 4th day of injections (the latter correspond to the first systematic control of platelet counts) in women who have an obstetric antiphospholipid antibody syndrome and who are initiating a new pregnancy with recommended treatment. Our goal is to test the prognostic value of these data on the occurrence of: - pregnancy loss categorized as embryonic loss (before 10 weeks gestation), fetal death (before 20 weeks gestation), stillbirths (from 20 weeks gestation to delivery), and neonatal death defined before reaching 28 days of age. - ischemic placental pathology (pre-eclampsia, retro-placental hematoma, birth of a small-for-gestational-age infant)

NCT02855047

Conditions

1. Antiphospholipid Syndrome

MeSH:Antiphospholipid Syndrome Syndrome

- Women in the APS subgroup: persistently positive for LA, and/or aCL and/or aBeta2GP1 - Women initiating a new pregnancy during the 18 month observational period after obstetric APS diagnosis Exclusion Criteria: - Any history of thrombotic events or any treatment given during previous pregnancies that might have modified the natural course of the condition - Women whose pregnancy losses could be explained by infectious, metabolic, anatomic or hormonal factors, or associated with paternal or maternal chromosomal causes - Seropositivity for HIV, hepatitis B or C - Women with antithrombin, protein C, or protein S deficiency, and women with abnormal fibrinogen or with the JAK2 V617F mutation were further excluded. --- V617F ---

To determine the safety of the approach of giving RUXOLITINIB before and after an autologous stem cell transplant, as measured by graft failure or death.

NCT02469974

Conditions

1. Myelofibrosis
2. MF

Interventions

1. Drug: RUXOLITINIB / INC 424
2. Drug: Filgrastim
3. Drug: Busulfan

MeSH:Primary Myelofibrosis

Changes in Jak 2 V617F allele burden when present will be measured by quantitative RT-PCR. --- V617F ---

The aim of the present study is to evaluate the efficacy and safety of MK-0683 in the treatment of PV and ET. This agent has most recently been shown to be a potent inhibitor of the autonomous proliferation of haematopoietic cells of PV and ET patients carrying the JAK2 V617F mutation. Accordingly, it may be anticipated that MK-0683 - by decreasing the JAK2 allele burden - may influence clonal myeloproliferation and in vivo granulocyte, platelet and endothelial activation , which are considered to be major determinants of morbidity and mortality ( thrombosis, bleeding, extramedullary haematopoiesis , myelofibrosis ) in these disorders. The effects of MK-0683 at the molecular level will be studied by global/ focused gene expression profiling, epigenome profiling and proteomics.

NCT00866762

Conditions

1. Polycythemia Vera
2. Essential Thrombocythemia

Interventions

1. Drug: HDAC inhibitor (MK-0683)

MeSH:Polycythemia Vera Polycythemia Thrombocytosis Thrombocythemia, Essential

HPO:Polycythemia Thrombocytosis

This agent has most recently been shown to be a potent inhibitor of the autonomous proliferation of haematopoietic cells of PV and ET patients carrying the JAK2 V617F mutation. --- V617F ---

This research is looking at two conditions, Essential Thrombocythemia (ET) and Polycythemia Vera (PV). ET causes people to produce too many blood cells called platelets and PV causes too many platelets and red blood cells to be made. Platelets are particles which circulate in the blood stream and normally prevent bleeding and bruising. Having too many platelets in the blood increases the risk of developing blood clots, which can result in life threatening events like heart attacks and strokes. When the number of red blood cells is increased in PV this will slow the speed of blood flow in the body and increases the risk of developing blood clots. The purpose of this study is to look at the effectiveness of giving participants who have been diagnosed with ET or PV one of two different study regimens over time. The study subject will be followed for their condition for about 5 years. The subject will be randomized into one of two study regimens, either Pegylated Interferon Alfa-2a (PEGASYS) or Aspirin and Hydroxyurea (also called Hydroxycarbamide). The subject must be newly diagnosed or already receiving treatment for either PV or ET. Each of the study drugs used in this study is already being used to treat subjects with ET or PV currently, but the investigators are unsure which study drug is better.

NCT01259856

Conditions

1. High Risk Polycythemia Vera
2. High Risk Essential Thrombocythemia

Interventions

1. Drug: PEGASYS
2. Drug: Hydroxyurea
3. Drug: Aspirin

MeSH:Polycythemia Vera Polycythemia Thrombocytosis Thrombocythemia, Essential

HPO:Polycythemia Thrombocytosis

The impact of PEGASYS on JAK2 will be measured by the allele burden; hematopoietic cell clonality will be measured by whether patients with clonal disease return to polyclonal; bone marrow histopathology will be measured by going from abnormal to normal; cytogenetic abnormalities will be measured by seeing if the cytogenetics go from abnormal to normal.To compare the impact of therapy on JAK2-V617F (JAK2), CALR, hematopoietic cell clonality in platelets and granulocytes in females, bone marrow histopathology, and cytogenetic abnormalities.. Number of Participants With Progression of Disease or Death. --- V617F ---

The aim of this research is to look at two conditions, Essential Thrombocythemia (ET) and Polycythemia Vera (PV). ET causes people to produce too many blood cells called platelets and PV causes too many platelets and red blood cells to be made. Platelets are particles which circulate in the blood stream and normally prevent bleeding and bruising. Having too many platelets in the blood increases the risk of developing blood clots, which can result in life threatening events like heart attacks and strokes. When the number of red blood cells is increased in PV this will slow the speed of blood flow in the body and increases the risk of developing blood clots. It is important for patients with ET or PV who are at risk of blood clots to receive drugs which will minimize the risks of developing these blood clots but at the moment the investigators are not sure which drugs will best control the disorder. The purpose of this study is to look at the effectiveness of giving patients who have been diagnosed with ET and PV a study drug regimen using Aspirin and PEGASYS (also known as Pegylated interferon alfa-2a, instead of the standard treatment drug called Hydroxyurea (or hydroxycarbamide or Hydroxyurea), for whom this drug may not be suitable. The drug may not be suitable either because it is not adequately controlling the number of blood cells or some specific side effects occur.

NCT01259817

Conditions

1. High Risk Polycythemia Vera
2. High Risk Essential Thrombocythemia

Interventions

1. Drug: PEGASYS
2. Drug: Aspirin

MeSH:Polycythemia Vera Polycythemia Thrombocytosis Thrombocythemia, Essential

HPO:Polycythemia Thrombocytosis

To measure the impact of Pegylated Interferon Alfa-2a on JAK2-V617F, CALR, hematopoietic cell clonality in platelets and granulocytes in females, bone marrow histopathology, and cytogenetic abnormalities.. --- V617F ---

For these patients the following additional inclusion/exclusion criteria apply: - > 3 months since onset of SVT - SVT treated with oral anticoagulants but no aspirin - Liver enzymes not > 2 times the normal value - Absence of encephalopathy, refractory or infected ascites, esophageal varicose of grade > 1 at time of trial entry - Bone marrow biopsy confirmed diagnosis of PV or ET - JAK2-V617F mutations present - These patients may have a normal blood count at trial entry - Age over 18 years (no upper age limit) - Able and willing to comply with study criteria - Signed and informed consent to participant in this study - Willing to participate in associated correlative science biomarker study - Serum creatinine < 1.5 x upper limit of normal - AST and ALT < 2 x upper limit of normal - Total bilirubin within normal limits Exclusion Criteria: - Patients cannot have any other form of chemotherapy for their MPD (other than hydroxyurea). --- V617F ---

The point mutation in JAK2 encodes a valine to phenylalanine change at position 617 (JAK2 V617F), and confers constitutive tyrosine kinase activity. --- V617F ---

Introducing the mutation into the bone marrow of mouse models recapitulates the PV phenotype (complete with evolution to bone marrow fibrosis) and inhibitors of JAK2 attenuate the growth of cell lines bearing the mutation in vitro and in vivo, suggesting that JAK2 V617F is a pathophysiologically relevant therapeutic target. --- V617F ---

It is estimated that 95% of PV cases carry JAK2 V617F, while 50 to 60% of ET and PMF cases are JAK2 V617F+. --- V617F ---

This phase I/II trial investigates the best dose and side effects of tazemetostat and how well it works in combination with dabrafenib and trametinib in treating patients with melanoma that has a specific mutation in the BRAF gene (BRAFV600) and that has spread to other places in the body (metastatic). Tazemetostat, dabrafenib, and trametinib may stop the growth of tumor cells by blocking some of the enzymes needed for cell growth. Giving tazemetostat with dabrafenib and trametinib may help treat patients with BRAFV600 mutated melanoma.

NCT04557956

Conditions

1. Clinical Stage IV Cutaneous Melanoma AJCC v8
2. Metastatic Malignant Neoplasm in the Central Nervous System
3. Metastatic Melanoma
4. Pathologic Stage IV Cutaneous Melanoma AJCC v8

Interventions

1. Drug: Dabrafenib Mesylate
2. Drug: Tazemetostat Hydrobromide
3. Drug: Trametinib Dimethyl Sulfoxide

MeSH:Melanoma Neoplasms Skin Neoplasms

HPO:Cutaneous melanoma Melanoma Neoplasm Neoplasm of the skin

JAK2 V617F) observed in cytogenetic testing and DNA sequencing - History of T-lymphoblastic lymphoma (T-LBL)/T-cell acute lymphoblastic leukemia (T-ALL) - Patients with history of RAS mutation-positive tumors are not eligible regardless of interval from the current study. --- V617F ---

A randomized controlled trial to study the efficacy and safety of Dabigatran in Cirrhotic patients who develop PVT.In this study the patients who meet the inclusion criteria will be randomized to either receive Dabigatran or placebo [multivitamin tablet]. Blood samples will be taken &Imaging will be done accordingly to notice progression or recanalization of PVT.The patients are followed up every 2 months up to 18 month .Then statistical analysis will be done to find whether the Dabigatran is efficacious in cirrhotic patients for recanalization of PVT.

NCT04433481

Conditions

1. Liver Cirrhosis
2. Portal Vein Thrombosis

Interventions

1. Drug: Dabigatran
2. Other: Placebo

MeSH:Liver Cirrhosis Thrombosis Venous Thrombosis Fibrosis

HPO:Cirrhosis Deep venous thrombosis Hepatic fibrosis Venous thrombosis

All included patients will be evaluated with - 1. Etiology of cirrhosis 2. Upper GI endoscopy 3. Haemogram (including reticulocyte count) 4. Coagulogram- PT/INR,APTT,TEG 5. Prothrombotic profile- protein c/protein-s/AT-III/Factor V Leiden mutation/ MTHFR C677T/PROTHROMBIN G20210A/ JAK2 V617F MUTATION / Anticardiolipin Ab. 6. Liver function tests, Renal function tests 7. Alpha fetoprotein/PIVKA II 8. USG abdomen with Doppler study 9. CECT-TP or CEMRI-TP to R/O HCC or angiography when PVT diagnosis doubtful. --- C677T --- --- G20210A --- --- V617F ---

In this prospective multicentric study, the University of Pavia together with the Fondazione IRCCS Policlinico San Matteo, Pavia and the IRCCS Fondazione Maugeri, Pavia, Italy will provide a systematic analysis of gene mutations in hematological malignancies by using NGS techniques. Patients with a conclusive diagnosis of haematological malignancies according to WHO criteria referred to the Rete Ematologica Lombarda clinical network (REL, www.rel-lombardia.net) will be enrolled. The investigators will analyse genomic DNA extracted from hematopoietic cells at different time points of patient disease. The study contemplates the use of molecular platforms (Next Generation Sequencing, NGS) aimed at the identification of recurrent mutations in myeloid and lymphoid neoplasms, respectively. Screening of gene mutations by NGS will be prospectively implemented in the context of REL clinical network. Patient samples will be analyzed at diagnosis and sequentially during the course of the disease at specific timepoints. The researchers will analyze the correlations between somatic mutations, specific clinical phenotypes (according to the WHO classification) and disease evolution. This will allow to: 1) identify new recurrent genetic mutations involved in the molecular pathogenesis of hematological malignancies; 2) define the role of mutated genes, distinguishing between genes which induce a clonal proliferation of hematopoietic stem cells, and genes which determine the clinical phenotype of the disease; 3) identify mutations which are responsible for disease evolution; 4) define the diagnostic/prognostic role of the identified mutations, and update the current disease classifications and prognostic scores by including molecular parameters. A systematic biobanking of biological material will be provided.

NCT02459743

Conditions

1. Hematological Malignancies

MeSH:Neoplasms Hematologic Neoplasms

HPO:Hematological neoplasm Leukemia Neoplasm

In 2005 the University of Pavia described the diagnostic and prognostic significance of the JAK2 V617F mutation in myeloproliferative neoplasms (MPN): this mutation was included into the WHO classification of MPN and innovative anti-JAK2 drugs were developed. --- V617F ---

Heat-shock proteins (HSP) have been very highly conserved throughout the evolution of species and are characterized by their chaperone function, thanks to their ability to prevent aggregation and to promote the renaturation/break down of damaged proteins. Among other targets, they also chaperone JAK2, a key step that is deregulated in signalling in myeloproliferative syndromes (MPS) because of the JAK2V617F mutation. These HSP also have a potent cytoprotective action through their multiples inhibiting effects on apoptotic processes. Little is known about levels of HSP expression, in particular for HSP70 and HSP27, in MPS cells. However, in vitro studies of different cell models have shown the interest of HSP90 inhibitors in slowing cell proliferation in MPS. These results have been confirmed in animal models with results in terms of blood counts and overall survival. In addition, it seems that the V617F mutated form of JAK2 is more sensitive than the wild-type to HSP90 inhibitors. Finally, inhibitors of HSP90 remain efficacious with regard to the inhibition of cell growth, even in cases of resistance to JAK2 inhibitors. Nonetheless, HSP90 inhibitors are known to stimulate the expression of other HSP, notably HSP27 and HSP70, which are, through their properties, tumorigenic and could lead to an escape phenomenon. Thus the combined use of several HSP inhibitors could be beneficial, and eventually present synergistic effects on the inhibition of tumour processes.

NCT02873832

Conditions

1. Myeloproliferative Syndrome

Interventions

1. Biological: Blood sample
2. Other: Flow cytometry
3. Other: western blot

MeSH:Myeloproliferative Disorders Syndrome

HPO:Myeloproliferative disorder

In addition, it seems that the V617F mutated form of JAK2 is more sensitive than the wild-type to HSP90 inhibitors. --- V617F ---

The purpose of this study is to determine the safety of and to select a treatment regimen of pomalidomide (CC-4047) either as single-agent or in combination with prednisone to study further in patients with myelofibrosis with myeloid metaplasia (MMM).

NCT00463385

Conditions

1. Myelofibrosis With Myeloid Metaplasia
2. Myeloid Metaplasia
3. Myelofibrosis

Interventions

1. Drug: Pomalidomide
2. Drug: Prednisone
3. Drug: Placebo to pomalidomide
4. Drug: Placebo to prednisone

MeSH:Primary Myelofibrosis Metaplasia

Percentage of participants who achieved a clinical response, presented by participants with positive and negative janus kinase 2 (JAK2) V617F mutation results at Baseline.. Number of Participants With Adverse Events (AEs). --- V617F ---

Myeloproliferative neoplasms (MPNs), including polycythemia vera, essential thrombocythemia, and primary myelofibrosis, may lead to gastroesophageal varices. The quality of life, morbidity, and mortality of MPN patients mainly depend on disease-related symptoms, thromboembolic and hemorrhagic complications. Previous studies have shown that JAK2 V617F has a prominent role in vascular risk and MPN-associated gastroesophageal varices. The aim of this study is to evaluate the efficacy of anticoagulation in patients with JAK2 mutation and gastroesophageal varices.

NCT04527666

Conditions

1. Gastroesophageal Varices
2. JAK2 Mutation
3. Myeloproliferative Neoplasm

Interventions

1. Drug: Anticoagulation Agents

MeSH:Esophageal and Gastric Varices Varicose Veins Myeloproliferative Disorders

HPO:Esophageal varix Gastric varix Myeloproliferative disorder Varicose veins

Previous studies have shown that JAK2 V617F has a prominent role in vascular risk and MPN-associated gastroesophageal varices. --- V617F ---

Myeloproliferative neoplasms (MPNs), including polycythemia vera, essential thrombocythemia, and primary myelofibrosis, may lead to gastroesophageal varices. The quality of life, morbidity, and mortality of MPN patients mainly depend on disease-related symptoms, thromboembolic and hemorrhagic complications. Previous studies have shown that JAK2 V617F has a prominent role in vascular risk and MPN-associated gastroesophageal varices. Portal vein thrombosis and portal cavernoma frequently occur in the MPN population and the management of gastroesophageal varices in these patients are sometimes technically difficult. The aim of this study is to investigate the the characteristics of patients with gastroesophageal varices and portal caver cavernoma with or without JAK2 mutation.

NCT04525768

Conditions

1. Gastroesophageal Varices
2. Myeloproliferative Neoplasm
3. Portal Caver Cavernoma
4. Portal Hypertension

Interventions

1. Diagnostic Test: JAK2 mutation test

MeSH:Hemangioma, Cavernous Hypertension, Portal Esophageal and Gastric Varices Hypertension Varicose Veins Myeloproliferative Disorders

HPO:Cavernous hemangioma Esophageal varix Gastric varix Hypertension Myeloproliferative disorder Portal hypertension Varicose veins

Previous studies have shown that JAK2 V617F has a prominent role in vascular risk and MPN-associated gastroesophageal varices. --- V617F ---

This phase II trial studies how well tazemetostat works in treating patients with ovarian or endometrial cancer that has come back (recurrent). Chemotherapy drugs, such as tazemetostat, work in different ways to stop the growth of tumor cells, either by killing the cells, by stopping them from dividing, or by stopping them from spreading.

NCT03348631

Conditions

1. FIGO Grade 1 Endometrial Endometrioid Adenocarcinoma
2. FIGO Grade 2 Endometrial Endometrioid Adenocarcinoma
3. Recurrent Endometrial Endometrioid Adenocarcinoma
4. Recurrent Ovarian Carcinoma
5. Recurrent Ovarian Clear Cell Adenocarcinoma
6. Recurrent Ovarian Endometrioid Adenocarcinoma
7. Recurrent Uterine Corpus Cancer

Interventions

1. Other: Laboratory Biomarker Analysis
2. Drug: Tazemetostat

MeSH:Carcinoma Adenocarcinoma Carcinoma, Endometrioid Adenocarcinoma, Clear Cell

HPO:Carcinoma

JAK2 V617F) observed in cytogenetic testing and deoxyribonucleic acid (DNA) sequencing - A prior history of T-cell lymphoblastic lymphoma (T-LBL)/T-cell acute lymphoblastic leukemia (T-ALL) - Severe, active co-morbidity per the treating investigator's discretion - Pregnant or lactating patients - Known human immunodeficiency virus (HIV) positive patients on combination antiretroviral therapy are ineligible because of the potential for pharmacokinetic interactions with tazemetostat; in addition, treatments involved in this protocol may be immunosuppressive, increasing the risk of lethal infections in this patient population - Treatment with strong inhibitors or inducers of CYP3A within 14 days of registration and during the study treatment Inclusion Criteria: - Pathologically (histologically or cytologically) proven diagnosis of recurrent or persistent ovarian endometrioid or clear cell carcinoma, OR recurrent or persistent endometrioid endometrial adenocarcinoma; patients with recurrent endometrial cancer must have mismatch repair (MMR) immunohistochemistry completed; if they are found to be mismatch repair deficient, they should be offered treatment with immune checkpoint inhibition before consideration for treatment on trial; primary ovarian tumors must be at least 50% endometrioid or clear cell morphology, or have histologically documented recurrence with at least 50% endometrioid or clear cell morphology; institutional pathology reports must be provided indicating at least 50% endometrioid or clear cell morphology for ovarian tumors (primary or recurrent lesions) - All patients must have measurable disease as defined by Response Evaluation Criteria in Solid Tumors (RECIST) version (v) 1.1; measurable disease is defined as at least one lesion that can be accurately measured in at least one dimension (longest diameter to be recorded); each lesion must be >= 10 mm when measured by computed tomography (CT), magnetic resonance imaging (MRI) or caliper measurement by clinical exam; or >= 20 mm when measured by chest x-ray; lymph nodes must be > 15 mm in short axis when measured by CT or MRI - Patients must have had at least one, but no more than 3, prior cytotoxic regimens for management of primary disease; unlimited prior hormonal therapy, targeted therapy (including immunotherapy) or antiangiogenic therapy will be permitted - Patients must have completed prior therapy: - Chemotherapy: cytotoxic - At least 28 days since last dose of chemotherapy prior to registration. --- V617F ---

JAK2 V617F) observed in cytogenetic testing and deoxyribonucleic acid (DNA) sequencing - A prior history of T-cell lymphoblastic lymphoma (T-LBL)/T-cell acute lymphoblastic leukemia (T-ALL) - Severe, active co-morbidity per the treating investigator's discretion - Pregnant or lactating patients - Known human immunodeficiency virus (HIV) positive patients on combination antiretroviral therapy are ineligible because of the potential for pharmacokinetic interactions with tazemetostat; in addition, treatments involved in this protocol may be immunosuppressive, increasing the risk of lethal infections in this patient population - Treatment with strong inhibitors or inducers of CYP3A within 14 days of registration and during the study treatment FIGO Grade 1 Endometrial Endometrioid Adenocarcinoma FIGO Grade 2 Endometrial Endometrioid Adenocarcinoma Recurrent Endometrial Endometrioid Adenocarcinoma Recurrent Ovarian Carcinoma Recurrent Ovarian Clear Cell Adenocarcinoma Recurrent Ovarian Endometrioid Adenocarcinoma Recurrent Uterine Corpus Cancer Carcinoma Adenocarcinoma Carcinoma, Endometrioid Adenocarcinoma, Clear Cell PRIMARY OBJECTIVE: I. To assess the clinical activity (overall response rate) of tazemetostat in patients with recurrent or persistent endometrioid or clear cell ovarian carcinoma, and patients with recurrent or persistent endometrioid endometrial adenocarcinoma. --- V617F ---

The primary objective of this study was to evaluate and compare the prevalence of the following psychiatric pathologies (based on the MINI5.0.0 questionnaire) among 3 groups of women (Leiden versus aP1Ab-positive versus thrombophilia-negative) with similar obstetrical histories 10 years after their initial assessment/diagnosis. - Mood disorders, including depressive episodes during the previous two weeks, recurrent depressive disorders at any point in life, dysthymia in the last two years, or any current or past manic episode; - Anxiety disorders, including current agoraphobia, current panic disorders, agoraphobia with panic disorders, current social phobia, generalized anxiety in the last 6 months, or current posttraumatic stress syndrome; - Apparent psychotic syndromes, including isolated or recurrent psychotic syndromes, past or present (clinically validated), - Current alcohol or drug problems (dependence or abuse).

NCT02833194

Conditions

1. Antiphospholipid Syndrome
2. Factor V Leiden Thrombophilia

MeSH:Thrombophilia Antiphospholipid Syndrome Syndrome Mental Disorders Problem Behavior

HPO:Behavioral abnormality Hypercoagulability

Exclusion Criteria: - Any history of thrombotic events or any treatment given during previous pregnancies that might have modified the natural course of the condition - Women whose pregnancy losses could be explained by infectious, metabolic, anatomic or hormonal facotrs, or associated with paternal or maternal chromosomal causes - Seropositivity for HIV, hepatitis B or C - Women with antithrombin, protein C, or protein S deficiency, and women with abnormal fibrinogen or with the JAK2 V617F mutation were further excluded. --- V617F ---

The three main chronic myeloproliferative disorders are polycythemia vera (PV), essential thrombocythemia (ET) and idiopathic myelofibrosis (IMF). These are clonal neoplastic diseases characterized by proliferation of one or more hematopoietic lineages. Recently a mutation of the Janus Kinase 2 (JAK2) gene that leads to the substitution of phenylalanine for valine at position 617 of the JAK2 protein, JAK2 V617F, has been found in 76% to 97% of patients with PV, 29% to 57% of patients with ET and 50% of patients with IMF. This mutation confers constitutive activity on to the JAK2 protein and appears to play an important role in the pathobiology of these conditions. However, not all patients with myeloproliferative disorders have this mutation and it may not be the primary cause of these diseases. The primary goal of this prospective natural history study is to investigate the molecular basis of these diseases in groups of patients who have JAK2 V617F and in those who do not. A second goal is to identify biomarkers for PV and the other myeloproliferative disorders that are easier to measure than JAK2 V617F. Approximately, 150 patients with myeloproliferative disorders will be studied over 3 years. The studies will involve the collection of 40 mL to 50 mL of peripheral blood from each subject. The blood will be used to assess neutrophil gene and protein expression, gene polymorphisms, and plasma protein levels.

NCT00433862

Conditions

1. Polycythemia Vera
2. Essential Thrombocytosis
3. Idiopathic Myelofibrosis
4. Neutrophils
5. Chronic Myeloproliferative Disorders

MeSH:Polycythemia Vera Primary Myelofibrosis Polycythemia Myeloproliferative Disorders Thrombocytosis Thrombocythemia, Essential Disease

HPO:Myeloproliferative disorder Polycythemia Thrombocytosis

Recently a mutation of the Janus Kinase 2 (JAK2) gene that leads to the substitution of phenylalanine for valine at position 617 of the JAK2 protein, JAK2 V617F, has been found in 76% to 97% of patients with PV, 29% to 57% of patients with ET and 50% of patients with IMF. --- V617F ---

The primary goal of this prospective natural history study is to investigate the molecular basis of these diseases in groups of patients who have JAK2 V617F and in those who do not. --- V617F ---

A second goal is to identify biomarkers for PV and the other myeloproliferative disorders that are easier to measure than JAK2 V617F. --- V617F ---

This phase I trial studies the best dose and side effects of tazemetostat in treating patients with solid tumors or B-cell lymphomas with liver dysfunction that have spread to other places in the body or cannot be removed by surgery. Tazemetostat may stop the growth of cancer cells by blocking some of the enzymes needed for cell growth.

NCT03217253

Conditions

1. Ann Arbor Stage III B-Cell Non-Hodgkin Lymphoma
2. Ann Arbor Stage IV B-Cell Non-Hodgkin Lymphoma
3. Metastatic Malignant Solid Neoplasm
4. Stage III Hepatocellular Carcinoma AJCC v7
5. Stage IIIA Hepatocellular Carcinoma AJCC v7
6. Stage IIIB Hepatocellular Carcinoma AJCC v7
7. Stage IIIC Hepatocellular Carcinoma AJCC v7
8. Stage IV Hepatocellular Carcinoma AJCC v7
9. Stage IVA Hepatocellular Carcinoma AJCC v7
10. Stage IVB Hepatocellular Carcinoma AJCC v7
11. Unresectable Solid Neoplasm

Interventions

1. Other: Laboratory Biomarker Analysis
2. Other: Pharmacological Study
3. Drug: Tazemetostat

MeSH:Lymphoma Carcinoma Neoplasms Lymphoma, Non-Hodgkin Carcinoma, Hepatocellular Lymphoma, B-Cell

HPO:B-cell lymphoma Carcinoma Hepatocellular carcinoma Lymphoma Neoplasm Non-Hodgkin lymphoma

JAK2 V617F) observed in cytogenetic testing and DNA sequencing - Has a prior history of T-acute lymphoblastic lymphoma (T-LBL)/T-acute lymphoblastic leukemia (ALL) Inclusion Criteria: - Patients must have histologically and/or cytologically confirmed solid tumors or B cell lymphoma that are metastatic or unresectable and for which standard treatment options do not exist; patients with hepatocellular carcinoma are eligible without pathological diagnosis if diagnosed on the basis of blood work and imaging - Patients with evaluable disease will be eligible - All patients must have completed any prior chemotherapy, targeted therapy and major surgery, >= 28 days before study entry; for daily or weekly chemotherapy without the potential for delayed toxicity, a washout period of 14 days may be acceptable, and questions related to this can be discussed with study principal investigator - Eastern Cooperative Oncology Group (ECOG) performance status =< 2 (Karnofsky >= 60%) - Life expectancy of greater than 3 months - Able to swallow and retain orally-administered medication and does not have any clinically significant gastrointestinal abnormalities that may alter absorption such as malabsorption syndrome or major resection of the stomach or bowels - All prior treatment-related toxicities must be Common Terminology Criteria for Adverse Events (CTCAE) version 5.0 grade =< 1 (except alopecia) at the time of enrollment - Leukocytes >= 3,000/mcL - Absolute neutrophil count >= 1,500/mcL - Platelets >= 100,000/mcL - Hemoglobin >= 90 g/L (9.0 g/dL) - Creatinine within normal institutional limits OR calculated creatinine clearance >= 60 mL/min/1.73 --- V617F ---

JAK2 V617F) observed in cytogenetic testing and DNA sequencing - Has a prior history of T-acute lymphoblastic lymphoma (T-LBL)/T-acute lymphoblastic leukemia (ALL) Ann Arbor Stage III B-Cell Non-Hodgkin Lymphoma Ann Arbor Stage IV B-Cell Non-Hodgkin Lymphoma Metastatic Malignant Solid Neoplasm Stage III Hepatocellular Carcinoma AJCC v7 Stage IIIA Hepatocellular Carcinoma AJCC v7 Stage IIIB Hepatocellular Carcinoma AJCC v7 Stage IIIC Hepatocellular Carcinoma AJCC v7 Stage IV Hepatocellular Carcinoma AJCC v7 Stage IVA Hepatocellular Carcinoma AJCC v7 Stage IVB Hepatocellular Carcinoma AJCC v7 Unresectable Solid Neoplasm Lymphoma Carcinoma Neoplasms Lymphoma, Non-Hodgkin Carcinoma, Hepatocellular Lymphoma, B-Cell PRIMARY OBJECTIVES: I. To determine safety, tolerability and recommended phase 2 dose (RP2D) of tazemetostat in patients with varying degrees of hepatic dysfunction. --- V617F ---

This is a phase I, multi-center, open-label, multi-dose, two-part PK and safety study to characterize the DDI potential of oral Tazemetostat.

NCT04537715

Conditions

1. All Malignancies
2. Advanced Malignancies
3. Hematologic Malignancy
4. Solid Tumor
5. Follicular Lymphoma (FL)
6. Non-Hodgkin Lymphoma (NHL)
7. Diffuse Large B-Cell Lymphoma (DLBCL)
8. Epithelioid Sarcoma (ES)
9. Synovial Sarcoma
10. Renal Medullary Carcinoma
11. Mesothelioma
12. Rhabdoid Tumor

Interventions

1. Drug: Tazemetostat
2. Drug: Itraconazole
3. Drug: Rifampin

MeSH:Lymphoma Neoplasms Sarcoma Lymphoma, Non-Hodgkin Lymphoma, Large B-Cell, Diffuse Mesothelioma Hematologic Neoplasms Sarcoma, Synovial Rhabdoid Tumor Carcinoma, Medullary

HPO:Hematological neoplasm Leukemia Lymphoma Neoplasm Non-Hodgkin lymphoma Sarcoma Soft tissue sarcoma Synovial sarcoma

Has abnormalities known to be associated with MDS (e.g., del 5q, chr 7 abn) and myeloproliferative neoplasms (MPN) (e.g., JAK2 V617F) observed in cytogenetic testing and DNA sequencing. --- V617F ---

Among the etiologies of thrombosis, myeloproliferative neoplasia (MPN) is quite rare but should be investigated in case of thrombosis of atypical localization (digestive or cerebral) or in the context of recurrent idiopathic thrombosis in a young subject. Thrombosis could reveal an underlying MPN through the identification of a JAK2 V617F mutation. Rarely, MPN with thrombotic complications present with normal complete blood count(CBC). In case of a MPN with a thrombotic event but without CBC abnormality, anti-thrombotic treatment is recommended. But there is no recommendation for the indication of cytoreductive therapy and the clinician's decision is often empirical. One of the major complications of for essential thrombocythemia (ET) or polycythemia vera (PV) is thrombosis and an age over 60 is a major risk factor. The treatment of thrombosis associated with TE or PV is based on recommendations the main therapeutic objective of which is to reduce the thrombotic risk. The combination of a cytoreducing agent and antithrombotic treatment is thus proposed in high-risk patients. The efficacy of this management is monitored by assessing CBC with the objective of normalization at <400 G/L of platelets for ET patients and <45% hematocrit in case of PV. The absence of abnormal CBC makes it difficult to justify cytoreduction. The benefit of such a therapy in this context has not been clinically demonstrated. If a cytoreductive therapy is initiated, no biological parameters are available to assess the response to treatment. The objective of this observational study is to evaluate the incidence of recurrence of thrombosis in patients whose thrombotic event revealed an underlying MPN with normal CBC. A comparison of groups treated or not with cytoreductive agents will be performed. Longitudinal monitoring of the patients will provide a better understanding of the nature and kinetics of hematological changes in these patients.

NCT04539678

Conditions

1. Thrombotic Patient
2. Thrombotic Patients
3. Diagnosis of Myeloproliferative Neoplasia
4. Impact of Treatment With Cytoreducing Agent

MeSH:Neoplasms

HPO:Neoplasm

Thrombosis could reveal an underlying MPN through the identification of a JAK2 V617F mutation. --- V617F ---

This study is hypothesis-generating to explore the impact of JAK2 (V617F) mutation status on the treatment response to anagrelide hydrochloride

NCT01352585

Conditions

1. Essential Thrombocythemia (ET)

Interventions

1. Drug: Anagrelide hydrochloride

MeSH:Thrombocytosis Thrombocythemia, Essential

HPO:Thrombocytosis

An Exploratory, Observational, Multicentre Study to Investigate the Impact of the Presence of JAK2 (V617F) Mutation on Treatment Response in Patients With Essential Thrombocythaemia Treated With XAGRID® (Anagrelide Hydrochloride). --- V617F ---

Exploratory Multi-centre Trial In Patients With ET Treated With XAGRID® This study is hypothesis-generating to explore the impact of JAK2 (V617F) mutation status on the treatment response to anagrelide hydrochloride Number of Patients With Platelet Count ≤600x10^9/L After 12 Months. --- V617F ---

This is a two-part, multicenter, open label, non-randomized, phase Ib/II study to assess the safety and tolerability, Maximum Tolerated Dose and preliminary efficacy of Givinostat in patients with JAK2V617F positive Polycythemia Vera. Part A is the dose finding part while Part B is assessing the preliminary efficacy. Patients will be enrolled either in Part A or Part B and transition from one part to the other is not allowed. Eligible patients for this study will have a confirmed diagnosis of Polycythemia Vera according to the revised World Health Organization criteria. Only if the enrolment in Part A is slow (i.e. < 5 patients enrolled in 3 months), eligibility for this part of the study may be expanded to all patients with chronic myeloproliferative neoplasms. Study therapy will be administered in 28 day cycles (4 weeks of treatment). Disease response will be evaluated according to the European LeukemiaNet criteria after 3 and 6 cycles (i.e. at weeks 12 and 24, respectively) of treatment with Givinostat for both parts of the study. All phlebotomies performed in the first 3 weeks of treatment will not be counted to assess the clinico-haematological response. The study will last up to a maximum of 24 weeks of treatment. However, after completion of the trial, all patients achieving clinical benefit will be allowed to continue treatment with Givinostat (at the same dose and schedule) in a long-term study. Safety will be monitored at each visit throughout the entire duration of the study. Treatment will be administered on an outpatient basis and patients will be followed regularly with physical and laboratory tests, as specified in the protocol; in case of hospitalization, the treatment will be continued or interrupted according to the Investigators' decision.

NCT01901432

Conditions

1. Polycythemia Vera

Interventions

1. Drug: Givinostat

MeSH:Polycythemia Vera Polycythemia

HPO:Polycythemia

dose group was not available for PK analysis.. Inclusion Criteria: 1. Patients must be able to provide informed consent and be willing to sign an informed consent form; 2. Patients must have an age ≥18 years; 3. Patients must have a confirmed diagnosis of Polycythemia Vera according to the revised World Health Organization criteria; 4. Patients must have mutated Janus Kinase 2 (mutation V617F) positive disease; 5. Patients must have an active/not controlled disease defined as 1. hematocrit ≥ 45% or hematocrit <45% in need of phlebotomy, and 2. platelet count > 400 x109/L, and 3. white blood cell count > 10 x109/L; 6. Patients must have an Eastern Cooperative Oncology Group (ECOG) performance status ≤ 1 in Part A, ECOG performance status ≤ 2 in Part B within 7 days of initiating study drug; 7. Female patient of childbearing potential has a negative serum or urine pregnancy test within 72 hours of the first dose of study therapy; 8. Use of an effective means of contraception for women of childbearing potential and men with partners of childbearing potential; 9. Adequate and acceptable organ function within 7 days of initiating study drug; 10. --- V617F ---

Inclusion Criteria: 1. Patients must be able to provide informed consent and be willing to sign an informed consent form; 2. Patients must have an age ≥18 years; 3. Patients must have a confirmed diagnosis of Polycythemia Vera according to the revised World Health Organization criteria; 4. Patients must have mutated Janus Kinase 2 (mutation V617F) positive disease; 5. Patients must have an active/not controlled disease defined as 1. hematocrit ≥ 45% or hematocrit <45% in need of phlebotomy, and 2. platelet count > 400 x109/L, and 3. white blood cell count > 10 x109/L; 6. Patients must have an Eastern Cooperative Oncology Group (ECOG) performance status ≤ 1 in Part A, ECOG performance status ≤ 2 in Part B within 7 days of initiating study drug; 7. Female patient of childbearing potential has a negative serum or urine pregnancy test within 72 hours of the first dose of study therapy; 8. Use of an effective means of contraception for women of childbearing potential and men with partners of childbearing potential; 9. Adequate and acceptable organ function within 7 days of initiating study drug; 10. --- V617F ---

The aim of this phase II study is to test a novel concept in the treatment of patients with myeloproliferative neoplasms (MPN), a disease of the bone marrow. With no current cure available, MPN are a group of chronic leukemias (blood cancers) in which patients produce too many blood cells. These increased blood cell numbers cause problems to the patient such as bleedings or thrombosis and some patients may progress to acute leukemia, a life threatening condition. Most MPN patients have a gene mutation called JAK2-V617F. The disease is maintained by mutant MPN stem cells that reside in the bone marrow in specialized locations called "niches". These niches need connections to the nervous system. New findings show that these connections are destroyed by the presence of the mutated MPN stem cells. Research teams found that some drugs (beta3-sympathicomimetics) can restore these damaged niches and at the same time reduce the MPN disease manifestation in a mouse model of MPN. Such sympathicomimetic drugs are already being used to treat patients with asthma or hyperactive bladder. These drugs have shown to have only few side effects. The study tests the effects of the beta-3-sympathicomimetic drug Mirabegron (Betmiga®) on MPN disease in 39 patients that carry a JAK2-V617F mutation. The hypothesis is that Mirabegron will have a beneficial effect on bone marrow niche cells and will thereby improve the disease manifestation in MPN patients. This study should provide a rapid answer whether targeting the nervous system of the niche cells could be useful for patients with MPN and warrants to be tested in larger and more long-term studies.

NCT02311569

Conditions

1. Myeloproliferative Neoplasm
2. Primary Myelofibrosis
3. Essential Thrombocythemia
4. Polycythemia Vera

Interventions

1. Drug: Mirabegron

MeSH:Neoplasms Polycythemia Vera Primary Myelofibrosis Myeloproliferative Disorders Polycythemia Thrombocytosis Thrombocythemia, Essential

HPO:Myeloproliferative disorder Neoplasm Polycythemia Thrombocytosis

Most MPN patients have a gene mutation called JAK2-V617F. --- V617F ---

The study tests the effects of the beta-3-sympathicomimetic drug Mirabegron (Betmiga®) on MPN disease in 39 patients that carry a JAK2-V617F mutation. --- V617F ---

Patients are defined as success for this endpoint, if they show a reduction of the JAK2-V617F allelic burden of 50% or more 24 weeks ± 4 weeks after registration when compared to baseline, and if they did not start a new MPN treatment before. --- V617F ---

Reduction in the burden of mutated alleles of ≥25% at 24 weeks (Red-25@24): Patients are defined as success for the Red-25@24 endpoint, if they show a reduction of the Jak2-V617F allelic burden of 25% or more 24 weeks ± 4 weeks after registration when compared to baseline, and if they did not start a new MPN treatment before. --- V617F ---

Reduction in the burden of mutated alleles of ≥25% at 12 weeks (Red-25@12) defined in the same way as the Red-25@24 endpoint, but evaluated at 12 weeks ± 4 weeks after registration.. Inclusion Criteria: - Histologically or cytologically confirmed diagnosis of JAK2-V617F positive ET, PV or PMF at primary diagnosis or pretreated - JAK2-V617F mutant allele burden > 20% in the peripheral blood at study entry - Patient must give written informed consent before registration - WHO performance status 0-2 - Age ≥ 18 years - Adequate hematological values: neutrophils ≥ 1.5 x 109/L, platelets ≥ 100 x 109/ L - Adequate hepatic function: bilirubin ≤ 1.5 x ULN, AST/ALT/AP ≤ 2.5 x ULN - Adequate renal function (calculated creatinine clearance > 50 mL/min, according to the formula of Cockcroft-Gault) - Women are not breastfeeding. --- V617F ---

Reduction in the burden of mutated alleles of ≥25% at 12 weeks (Red-25@12) defined in the same way as the Red-25@24 endpoint, but evaluated at 12 weeks ± 4 weeks after registration.. Inclusion Criteria: - Histologically or cytologically confirmed diagnosis of JAK2-V617F positive ET, PV or PMF at primary diagnosis or pretreated - JAK2-V617F mutant allele burden > 20% in the peripheral blood at study entry - Patient must give written informed consent before registration - WHO performance status 0-2 - Age ≥ 18 years - Adequate hematological values: neutrophils ≥ 1.5 x 109/L, platelets ≥ 100 x 109/ L - Adequate hepatic function: bilirubin ≤ 1.5 x ULN, AST/ALT/AP ≤ 2.5 x ULN - Adequate renal function (calculated creatinine clearance > 50 mL/min, according to the formula of Cockcroft-Gault) - Women are not breastfeeding. --- V617F --- --- V617F ---

Inclusion Criteria: - Histologically or cytologically confirmed diagnosis of JAK2-V617F positive ET, PV or PMF at primary diagnosis or pretreated - JAK2-V617F mutant allele burden > 20% in the peripheral blood at study entry - Patient must give written informed consent before registration - WHO performance status 0-2 - Age ≥ 18 years - Adequate hematological values: neutrophils ≥ 1.5 x 109/L, platelets ≥ 100 x 109/ L - Adequate hepatic function: bilirubin ≤ 1.5 x ULN, AST/ALT/AP ≤ 2.5 x ULN - Adequate renal function (calculated creatinine clearance > 50 mL/min, according to the formula of Cockcroft-Gault) - Women are not breastfeeding. --- V617F ---

Inclusion Criteria: - Histologically or cytologically confirmed diagnosis of JAK2-V617F positive ET, PV or PMF at primary diagnosis or pretreated - JAK2-V617F mutant allele burden > 20% in the peripheral blood at study entry - Patient must give written informed consent before registration - WHO performance status 0-2 - Age ≥ 18 years - Adequate hematological values: neutrophils ≥ 1.5 x 109/L, platelets ≥ 100 x 109/ L - Adequate hepatic function: bilirubin ≤ 1.5 x ULN, AST/ALT/AP ≤ 2.5 x ULN - Adequate renal function (calculated creatinine clearance > 50 mL/min, according to the formula of Cockcroft-Gault) - Women are not breastfeeding. --- V617F --- --- V617F ---

Three genes are frequently mutated in MPN and are implicated to be the phenotypic driver mutations: more than 95% of PV patients carry a somatic JAK2-V617F mutation, while about half of the remaining PV patients (2-3%) display mutations in JAK2 exon 12. Thus, almost all patients with PV have somatic mutations in the JAK2 gene. --- V617F ---

The mutational profiles of ET and PMF are more diverse: JAK2-V617F is found in 50-60% of the patients, whereas the recently described mutations in calreticulin (CALR) occur in 20-25% of the patients. --- V617F ---

Ruxolitinib, recently approved for PMF with splenomegaly, is effective in reducing spleen size and improving quality of life, but has little effect on the JAK2-V617F mutant allele burden and has so far not been reported to induce remissions. --- V617F ---

Furthermore, in a mouse model of MPN expressing the human JAK2-V617F mutation, this effect was found to be caused by early glial and sympathetic nerve damage and apoptosis of nestin+ MSCs triggered by the mutant HSCs. --- V617F ---

Mice with JAK2-V617F driven MPN treated with a beta-3-sympathicomimetic agonist not only restored nestin+ MSCs numbers, but also showed correction of thrombocytosis, neutrophilia, and bone marrow fibrosis, and efficiently reduced mutant hematopoietic progenitor numbers in bone marrow and peripheral blood. --- V617F ---

Primary Objective: - To evaluate the efficacy of once daily dose of SAR302503 in subjects previously treated with ruxolitinib and with a current diagnosis of intermediate-1 with symptoms, Intermediate-2 or high-risk primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (Post-PV MF), or post-essential thrombocythemia myelofibrosis (Post-ET MF) based on the reduction of spleen volume at the end of 6 treatment cycles; Secondary Objectives: - To evaluate the effect of SAR302503 on Myelofibrosis (MF) associated symptoms as measured by the modified Myelofibrosis Symptom Assessment Form (MFSAF) diary - To evaluate the durability of splenic response - To evaluate the splenic response to SAR302503 by palpation at the end of Cycle 6 - To evaluate the splenic response to SAR302503 at the end of Cycle 3 - To evaluate the effect of SAR302503 on the Janus kinase 2 (JAK2) V617F allele burden - To evaluate the safety and tolerability of SAR302503 in this population - To evaluate plasma concentrations of SAR302503 for population PK analysis, if warranted

NCT01523171

Conditions

1. Hematopoietic Neoplasm

Interventions

1. Drug: SAR302503

MeSH:Hematologic Neoplasms Primary Myelofibrosis

HPO:Hematological neoplasm Leukemia

Phase II, Open Label, Single Arm Study of SAR302503 In Myelofibrosis Patients Previously Treated With Ruxolitinib Primary Objective: - To evaluate the efficacy of once daily dose of SAR302503 in subjects previously treated with ruxolitinib and with a current diagnosis of intermediate-1 with symptoms, Intermediate-2 or high-risk primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (Post-PV MF), or post-essential thrombocythemia myelofibrosis (Post-ET MF) based on the reduction of spleen volume at the end of 6 treatment cycles; Secondary Objectives: - To evaluate the effect of SAR302503 on Myelofibrosis (MF) associated symptoms as measured by the modified Myelofibrosis Symptom Assessment Form (MFSAF) diary - To evaluate the durability of splenic response - To evaluate the splenic response to SAR302503 by palpation at the end of Cycle 6 - To evaluate the splenic response to SAR302503 at the end of Cycle 3 - To evaluate the effect of SAR302503 on the Janus kinase 2 (JAK2) V617F allele burden - To evaluate the safety and tolerability of SAR302503 in this population - To evaluate plasma concentrations of SAR302503 for population PK analysis, if warranted Response Rate (RR), defined as the proportion of subjects who have a ≥35% reduction from baseline in volume of spleen at the end of Cycle 6 as measured by Magnetic Resonance Imaging (MRI) (or CT scan in subjects with contraindications for MRI). --- V617F ---

A multicenter, open-label expanded access program to provide access to tazemetostat to Epithelioid Sarcoma (ES) patients in serious need who are otherwise unable to participate in a clinical study or whom access is not available through marketed product in the US.

NCT04225429

Conditions

1. Epithelioid Sarcoma

Interventions

1. Drug: Tazemetostat

MeSH:Sarcoma

HPO:Sarcoma Soft tissue sarcoma

JAK2 V617F) observed in cytogenetic testing and DNA sequencing. --- V617F ---

Objectives: To compare the efficacy and safety in children (<18 years) diagnosed as essential thrombocythemia treated with the Pegylated Interferon Alfa-2b vs. Interferon Alfa. Study Design: A prospective, open-label, nonrandomized, single-center clinical trial

NCT04226950

Conditions

1. Essential Thrombocytopenia

Interventions

1. Drug: Recombinant Interferon Alpha
2. Drug: Pegylated interferon alfa-2b

MeSH:Thrombocytopenia Thrombocytosis Thrombocythemia, Essential

HPO:Thrombocytopenia Thrombocytosis

- Platelet count ≥ 450 × 109 / L for more than 6 months（If the patient has JAK2 V617F, CALR or MPL gene mutation, the history may be less than 6 months） - Platelet count ≥ 1000 × 109 / L at screening - The guardians has provided written informed consent prior to enrollment Exclusion Criteria: - Known to meet the criteria for primary myelofibrosis or polycythemia vera by 2016 WHO criteria - Presence of any life-threatening co-morbidity - Secondary thrombocytosis - Familial thrombocytosis - Resistance, or intolerance, or any contraindications to interferon - Interferon is used in the past 1 month before enrollment - Patients with previous or present thrombosis or active bleeding - WBC<4× 109 / L - HGB<110g/L - Poor control of thyroid dysfunction - Patients with a prior malignancy within the last 3 years - Patients with severe cardiac or pulmonary dysfunction - Severe renal damage (creatinine clearance < 30 ml / min) - Severe liver dysfunction (ALT or AST > 2.5×ULN) - Patients diagnosed as diabetes with poor control - Patients with hepatitis B virus, hepatitis C virus replication or HIV infection - Patients with a history of drug / alcohol abuse (within 2 years before the study) - Patients that have participated in other experimental researches within one month before enrollment - History of psychiatric disorder - Any other circumstances that the investigator considers that the patient is not suitable to participate in the trial Inclusion Criteria: - <18 years old - Male or Female - Diagnosis of essential thrombocythemia according to the 2016 WHO criteria. --- V617F ---

- Platelet count ≥ 450 × 109 / L for more than 6 months（If the patient has JAK2 V617F, CALR or MPL gene mutation, the history may be less than 6 months） - Platelet count ≥ 1000 × 109 / L at screening - The guardians has provided written informed consent prior to enrollment Exclusion Criteria: - Known to meet the criteria for primary myelofibrosis or polycythemia vera by 2016 WHO criteria - Presence of any life-threatening co-morbidity - Secondary thrombocytosis - Familial thrombocytosis - Resistance, or intolerance, or any contraindications to interferon - Interferon is used in the past 1 month before enrollment - Patients with previous or present thrombosis or active bleeding - WBC<4× 109 / L - HGB<110g/L - Poor control of thyroid dysfunction - Patients with a prior malignancy within the last 3 years - Patients with severe cardiac or pulmonary dysfunction - Severe renal damage (creatinine clearance < 30 ml / min) - Severe liver dysfunction (ALT or AST > 2.5×ULN) - Patients diagnosed as diabetes with poor control - Patients with hepatitis B virus, hepatitis C virus replication or HIV infection - Patients with a history of drug / alcohol abuse (within 2 years before the study) - Patients that have participated in other experimental researches within one month before enrollment - History of psychiatric disorder - Any other circumstances that the investigator considers that the patient is not suitable to participate in the trial Essential Thrombocytopenia Thrombocytopenia Thrombocytosis Thrombocythemia, Essential This is a prospective, open-label, nonrandomized, single-center clinical trial between Interferon Alfa and Pegylated Interferon Alfa-2b in childhood essential thrombocythemia (<18 years). --- V617F ---

Patients with following conditions are eligible to enroll in the EAP: - Epithelioid Sarcoma (ES) - Spindle cell sarcoma - Sinonasal carcinoma - Small Cell Carcinoma of the Ovary Hypercalcemic Type (SCCOHT) - Thoracic sarcoma - Poorly differentiated chordoma These conditions must be serious or life-threatening at the time of enrollment and appropriate, comparable, or satisfactory alternative treatments must have been tried without clinical success. Patients with conditions not listed above are not eligible for the tazemetostat EAP

NCT03874455

Conditions

1. Epithelioid Sarcoma
2. Spindle Cell Sarcoma
3. Sinonasal Carcinoma
4. Small Cell Carcinoma of the Ovary Hypercalcemic Type
5. Thoracic Sarcoma
6. Poorly Differentiated Chordoma

Interventions

1. Drug: Tazemetostat

MeSH:Carcinoma Sarcoma Chordoma Carcinoma, Small Cell Small Cell Lung Carcinoma Carcinoma, Ovarian Epithelial

HPO:Carcinoma Chordoma Sarcoma Small cell lung carcinoma Soft tissue sarcoma

JAK2 V617F) observed in cytogenetic testing and DNA sequencing. --- V617F ---

This phase I/II trial studies the side effects and best dose of tazemetostat and how well it works when given together with pembrolizumab in treating patients with urothelial carcinoma that has spread to nearby tissue or lymph nodes or other places in the body (locally advanced/metastatic). Tazemetostat may stop the growth of tumor cells by blocking some of the enzymes needed for cell growth. Immunotherapy with monoclonal antibodies, such as pembrolizumab, may help the body's immune system attack the cancer, and may interfere with the ability of tumor cells to grow and spread. Giving tazemetostat and pembrolizumab may work better in treating patients with urothelial carcinoma compared to pembrolizumab without tazemetostat.

NCT03854474

Conditions

1. Locally Advanced Urothelial Carcinoma
2. Metastatic Urothelial Carcinoma
3. Stage III Bladder Cancer AJCC v8
4. Stage IIIA Bladder Cancer AJCC v8
5. Stage IIIB Bladder Cancer AJCC v8
6. Stage IV Bladder Cancer AJCC v8
7. Stage IVA Bladder Cancer AJCC v8
8. Stage IVB Bladder Cancer AJCC v8

Interventions

1. Biological: Pembrolizumab
2. Drug: Tazemetostat

MeSH:Carcinoma Urinary Bladder Neoplasms Carcinoma, Transitional Cell

HPO:Bladder neoplasm Carcinoma

JAK2 V617F) observed in cytogenetic testing and deoxyribonucleic acid (DNA) sequencing are not eligible - Patients with a prior history of T-cell lymphoblastic lymphoma (T-LBL) or T-cell acute lymphoblastic leukemia (T-ALL) are not eligible - Patients who have received prior PD-L1/PD-1/PD-L2 or EZH2 inhibitor therapy are not eligible - Patients who have had a prior monoclonal antibody within 4 weeks prior to study day 1 are not eligible - Patients with a known additional malignancy that is progressing or requires active treatment are not eligible. --- V617F ---

The term "therapy-related" leukemia is descriptive and is based on a patient's history of exposure to cytotoxic agents. Although a causal relationship is implied, the mechanism remains to be proven. These neoplasms are thought to be the direct consequence of mutational events induced by the prior therapy Therapy-related myelodysplastic syndromes / acute myeloid leukemia (t- MDS / t-AML) is now considered a single entity, called therapy-related myeloid neoplasms based on the current World Health Organization WHO classification2,. It is a well-recognized clinical syndrome occurring as a late complication following Cytotoxic agents and ionizing radiotherapy in the treatment of most cancer types: Hodgkin lymphoma (HL), non-Hodgkin lymphoma (NHL), acute lymphoblastic leukemia (ALL), sarcoma, and ovarian and testicular cancerThe incidence of t-MDS/AML following conventional therapy ranges from 0.8% to 6.3% at 20 years. The median time to development of t-MDS/AML is 3 to 5 years, with the risk decreasing markedly after the first decade Two types of t-MDS/AML are recognized in the WHO classification depending on the causative therapeutic exposure: an alkylating agent/radiation-related type and a topoisomerase II inhibitor-related type. Alkylating agent-related t-MDS/AML usually appears 4 to 7 years after exposure to the mutagenic agent .The reciprocal translocation t(8;9) (p22;p24) between the short arm of chromosome 8 and the long arm of chromosome 9 is a recurrent abnormality that fuses the Janus activated kinase 2 (JAK2) to the human autoantigen pericentriolar material 1 gene (PCM1) , with breakage and reunion at bands 8p11 and 9q3410Due to PCM1-JAK2 gene fusion, the coiled-coil domains of PCM1 mediate an oligomerization that brings together the linked JAK2 domains resulting in a constitutively activated tyrosine kinase domain of JAK2The most common mechanism for JAK2 activation in hematologic malignancies is the point mutation at position 617 (V617F). The consequences of JAK2 activation are neoplastic transformation and abnormal cell proliferation in various malignancies - So, translocations involving the JAK2 locus are considered of oncogenic importance in acute leukemias and myelodysplastic/ myeloproliferative diseases. - Patients with this abnormality present with broad clinical spectrum ranging from chronic to acute hematological diseases with myeloid or lymphoid appearance

NCT03943394

Conditions

1. Detection of PCM1-JAK2 Fusion Gene by FISH in the Two Types of t-MDS/AML and Relationship Between PCM1-JAK2 Fusion Gene and Cumulative Dose, Dose Intensity

Interventions

1. Other: fresh samples are obtained from patients for detction of PCM1- JAK2 fusion gene

Alkylating agent-related t-MDS/AML usually appears 4 to 7 years after exposure to the mutagenic agent .The reciprocal translocation t(8;9) (p22;p24) between the short arm of chromosome 8 and the long arm of chromosome 9 is a recurrent abnormality that fuses the Janus activated kinase 2 (JAK2) to the human autoantigen pericentriolar material 1 gene (PCM1) , with breakage and reunion at bands 8p11 and 9q3410Due to PCM1-JAK2 gene fusion, the coiled-coil domains of PCM1 mediate an oligomerization that brings together the linked JAK2 domains resulting in a constitutively activated tyrosine kinase domain of JAK2The most common mechanism for JAK2 activation in hematologic malignancies is the point mutation at position 617 (V617F). --- V617F ---

The most common mechanism for JAK2 activation in hematologic malignancies is the point mutation at position 617 (V617F). --- V617F ---

This pilot phase II trial studies P1101 (polyethyleneglycol [PEG]-proline-interferon alpha-2b) in treating patients with myelofibrosis. PEG-proline-interferon alpha-2b is a substance that can improve the body's natural response and may slow the growth of myelofibrosis.

NCT02370329

Conditions

1. Primary Myelofibrosis
2. Secondary Myelofibrosis

Interventions

1. Other: Laboratory Biomarker Analysis
2. Biological: PEG-Proline-Interferon Alfa-2b
3. Other: Quality-of-Life Assessment

MeSH:Primary Myelofibrosis

To evaluate the impact of P1101 on bone marrow and histological features of myelofibrosis including cytogenetics, blast percentage, fibrosis, and JAK2-V617F allele burden by cohort (early vs intermediate-2/high risk). --- V617F ---

This is a phase 1, 2-part, global, multicenter, open-label, PK, safety and tolerability study of oral tazemetostat in subjects with either advanced solid tumors, or hematological malignancies and normal hepatic function or moderate, or severe hepatic impairment.

NCT04241835

Conditions

1. Hepatic Impairment
2. Advanced Malignant Solid Tumor

Interventions

1. Drug: Tazemetostat

MeSH:Liver Diseases

HPO:Abnormality of the liver Decreased liver function Elevated hepatic transaminase

JAK2 V617F) observed in cytogenetic testing and DNA sequencing 13. --- V617F ---

This early phase I trial studies how well the use of a continuous positive airway pressure (CPAP) machine works in treating obstructive sleep apnea in patients with polycythemia vera or essential thrombocythemia. Obstructive sleep apnea is a condition where a person stops breathing during sleep, and is estimated to affect 30 to 50 percent of patients with polycythemia vera or essential thrombocythemia. A patient with obstructive sleep apnea typically snores, has disrupted sleep, experiences morning headaches, and has daytime sleepiness. Patients diagnosed with obstructive sleep apnea are typically treated with a device called CPAP. The CPAP provides pressurized air that keeps upper air passages open during sleep and may prevent them from narrowing or collapsing as occurs during snoring or sleep apnea.

NCT03972943

Conditions

1. CALR Gene Mutation
2. Essential Thrombocythemia
3. JAK2 Gene Mutation
4. MPL Gene Mutation
5. Obstructive Sleep Apnea Syndrome
6. Polycythemia Vera

Interventions

1. Procedure: Continuous Positive Airway Pressure
2. Other: Patient Observation
3. Other: Questionnaire Administration

MeSH:Polycythemia Vera Apnea Sleep Apnea Syndromes Sleep Apnea, Obstructive Polycythemia Thrombocytosis Thrombocythemia, Essential

HPO:Apnea Obstructive sleep apnea Polycythemia Sleep apnea Thrombocytosis

Paired Wilcoxon tests will be used to analyze variables that are highly skewed or otherwise non-Gaussian in distribution.. Change in JAK2 V617F allele burden. --- V617F ---

Pulmonary arterial hypertension (PAH) is a serious and eventually fatal disease damaging the lungs and the heart. It results from narrowing and eventual blockage of small blood vessels in the lung, due to abnormal proliferation of cells in the blood vessel (arterial). Patients with PAH suffer from fatigue, shortness of breath, low oxygen levels, blood clots and heart failure. No therapies reverse the disease process in the lung arteries, however there are three approved drugs that can temporarily dilate the vessels and improve symptoms. However, all three drugs have significant side effects and toxicities, they do not work effectively in many patients, survival remains on average only 2 to 3 years once symptoms begin, and none of these drugs prevent the underlying disease process in the small arteries of the lung. PAH is known to develop in patients with a pre-existing class of bone marrow diseases called myeloproliferative disorders (MPDs). We and others have recently shown that patients with PAH have bone marrow changes similar to those seen in patients with MPDs, even without other signs and symptoms of those bone marrow diseases such as anemia or high platelet and white blood cell counts. Compared to healthy volunteers, patients with PAH have a higher frequency of immature stem and progenitor cells able to produce blood cells and vascular wall cells in their bone marrow. They also have higher circulating numbers of these cells in the blood, and increased localization of these cells in the lung blood vessels. When immature bone marrow cells from PAH patients and normal volunteers were infused into mice, the mice receiving PAH marrow cells developed similar lung and heart problems to PAH patients, suggesting that the bone marrow problem is a primary cause of the lung problems, and that the increased numbers of immature bone marrow cells in the bone marrow and blood of PAH patients causes the lung blood vessel disease. The drug hydroxyurea is used to inhibit the abnormally high level of bone marrow cell proliferation in patients with MPDs. It has been shown to reduce the numbers of circulating immature bone marrow cells in patients with MPDs. Hydroxyurea has been available for almost fifty years, and has been used to treat patients with MPDs, sickle cell anemia, and congenital heart disease for very prolonged periods of time, up to twenty or more years in individual patients. It has an excellent long-term safety profile and few side effects and is generally well tolerated. It does not appear to result in an increased rate of leukemia even with many years of treatment. In the current protocol, we hypothesize that treating patients with PAH with hydroxyurea will decrease the level of circulating immature bone marrow cells and interrupt the abnormal narrowing and occlusion of lung arteries. We will treat patients with moderately severe primary (no known underlying cause) PAH with 6 months of hydroxyurea, carefully monitoring side effects and adjusting dosage as necessary, and measure the effect on circulating immature cells, lung blood vessel pressures, other blood markers of active PAH, and exercise tolerance.

NCT01950585

Conditions

1. Pulmonary Hypertension

Interventions

1. Drug: Hydroxyurea

MeSH:Hypertension, Pulmonary Familial Primary Pulmonary Hypertension Hypertension

HPO:Hypertension Pulmonary arterial hypertension

- HIV positivity - Moribund status or concurrent hepatic, renal, cardiac, neurologic, pulmonary, infectious, or metabolic disease of such severity that it would preclude the patient s ability to tolerate protocol therapy, or that death within 30 days is likely - Presence of 9;22 BCR/ABL translocation as detected by conventional bone marrow cytogenetics or PCR for BCR/ABL transcript, or presence of JAK2 V617F mutation in bone marrow or peripheral blood cells. --- V617F ---

This trial aimed to investigate the therapeutic efficacy of ruxolitinib in combination with cytotoxic chemotherapy for post-myeloproliferative neoplasm secondary acute myeloid leukemia.

NCT03558607

Conditions

1. Secondary Acute Myelogenous Leukemia Evolving From Myeloproliferative Disorder

Interventions

1. Drug: Ruxolitinib

MeSH:Leukemia Neoplasms Neoplasm Metastasis Leukemia, Myeloid Leukemia, Myeloid, Acute Myeloproliferative Disorders

HPO:Acute megakaryocytic leukemia Acute myeloid leukemia Leukemia Myeloid leukemia Myeloproliferative disorder Neoplasm

JAK2 V617F mutation, which is a hallmark of MPN, has been reported to be carried in approximately 35-50% of patients with post-MPN AML. --- V617F ---

The aim of the study is to examine (a) whether patients with JAK2 V617F positive ET in comparison to age-and sex-matched, apparently healthy control subjects show more advanced progression of arterial stiffness, pulse-wave velocity and coronary calcium score in a 4 year observation period, and (b) whether the burden of JAK2 V617F mutation correlates with the measured vascular parameters. All subjects will be examined twice. The first visit already took place between the years 2014 - 2015 and the second visit will take place between 2018-2019. All participants will have signed their informed consent before entering the study. Each visit will consist of completing a structured questionnaire (on personal and family medical history, risk factors for CVD and medication), physical examination, donating a blood sample for laboratory tests and undergoing carotid ultrasound and coronary calcium measurement oft the extent of coronary artery calcification. At the first and the second examination the JAK2 V617F allele burden, i.e. the percentage of mutated alleles, will be determined from genomic DNA in peripheral blood.

NCT03828422

Conditions

1. Atherosclerosis

Interventions

1. Diagnostic Test: imaging

MeSH:Atherosclerosis Thrombocytosis Thrombocythemia, Essential

HPO:Atherosclerosis Thrombocytosis Type IV atherosclerotic lesion

Arterial Function and Atherosclerosis in Essential Thrombocythemia The aim of the study is to examine (a) whether patients with JAK2 V617F positive ET in comparison to age-and sex-matched, apparently healthy control subjects show more advanced progression of arterial stiffness, pulse-wave velocity and coronary calcium score in a 4 year observation period, and (b) whether the burden of JAK2 V617F mutation correlates with the measured vascular parameters. --- V617F ---

Arterial Function and Atherosclerosis in Essential Thrombocythemia The aim of the study is to examine (a) whether patients with JAK2 V617F positive ET in comparison to age-and sex-matched, apparently healthy control subjects show more advanced progression of arterial stiffness, pulse-wave velocity and coronary calcium score in a 4 year observation period, and (b) whether the burden of JAK2 V617F mutation correlates with the measured vascular parameters. --- V617F --- --- V617F ---

At the first and the second examination the JAK2 V617F allele burden, i.e. the percentage of mutated alleles, will be determined from genomic DNA in peripheral blood. --- V617F ---

Change of carotid artery stiffness (expressed by beta-stiffness index and pulse wave velocity) in JAK2 V617F positive ET patients in comparison to healthy control subjects in a 4-year period.. Do patients with JAK2 V617F positive ET in comparison to age-and sex-matched, apparently healthy control subjects show more advanced progression of carotid artery stiffness (expressed as two interrelated parameters, the beta-stiffness index and the pulse wave velocity) in a 4 year observation period?. --- V617F ---

Change of carotid artery stiffness (expressed by beta-stiffness index and pulse wave velocity) in JAK2 V617F positive ET patients in comparison to healthy control subjects in a 4-year period.. Do patients with JAK2 V617F positive ET in comparison to age-and sex-matched, apparently healthy control subjects show more advanced progression of carotid artery stiffness (expressed as two interrelated parameters, the beta-stiffness index and the pulse wave velocity) in a 4 year observation period?. --- V617F --- --- V617F ---

Change of carotid artery plaque score in JAK2 V617F positive ET patients in comparison to healthy control subjects in a 4-year period.. Do patients with JAK2 V617F positive ET in comparison to age-and sex-matched, apparently healthy control subjects show more advanced progression of carotid plaque score in a 4 year observation period? --- V617F ---

Change of carotid artery plaque score in JAK2 V617F positive ET patients in comparison to healthy control subjects in a 4-year period.. Do patients with JAK2 V617F positive ET in comparison to age-and sex-matched, apparently healthy control subjects show more advanced progression of carotid plaque score in a 4 year observation period? --- V617F --- --- V617F ---

Thus, the carotid plaque score ranges from 0 (absence of plaques, best) to 6 (plaques present in all segments on both sides, worst outcome).. Change of coronary calcium burden in JAK2 V617F positive ET patients in comparison to healthy control subjects in a 4-year period.. Do patients with JAK2 V617F positive ET in comparison to age-and sex-matched, apparently healthy control subjects show more advanced progression of coronary calcium score in a 4 year observation period?. --- V617F ---

Thus, the carotid plaque score ranges from 0 (absence of plaques, best) to 6 (plaques present in all segments on both sides, worst outcome).. Change of coronary calcium burden in JAK2 V617F positive ET patients in comparison to healthy control subjects in a 4-year period.. Do patients with JAK2 V617F positive ET in comparison to age-and sex-matched, apparently healthy control subjects show more advanced progression of coronary calcium score in a 4 year observation period?. --- V617F --- --- V617F ---

Change of digital endothelial function, expressed as the Reactive Hyperemia Index, in JAK2 V617F positive ET patients in comparison to healthy control subjects in a 4-year period.. Do patients with JAK2 V617F positive ET in comparison to age-and sex-matched, apparently healthy control subjects show greater changes digital endothelial function, expressed as the Reactive Hyperemia Index (RHI), in a 4 year observation period? --- V617F ---

Change of digital endothelial function, expressed as the Reactive Hyperemia Index, in JAK2 V617F positive ET patients in comparison to healthy control subjects in a 4-year period.. Do patients with JAK2 V617F positive ET in comparison to age-and sex-matched, apparently healthy control subjects show greater changes digital endothelial function, expressed as the Reactive Hyperemia Index (RHI), in a 4 year observation period? --- V617F --- --- V617F ---

RHI ranges from 1 (no augmentation of pulsation with reactive hyperemia, i.e. worst outcome) to values above 2 (good endothelial response to reactive hyperemia).. Association of the JAK2 V617F mutation burden with the coronary calcium burden.. Quantification of JAK2 V617F mutation burden and its correlation with the coronary calcium burden.. Inclusion Criteria: - patients with JAK2 V617F positive essential thrombocythemia - age-and sex-matched apparently healthy control subjects Exclusion Criteria: - personal history of any atherosclerotic vascular disease (myocardial infarction, angina pectoris, peripheral arterial disease, aortic disease, transient ischemic attack or ischemic stroke) - chronic kidney disease stage 3 and above - known cancer - chronic inflammatory disease - autoimmune disease - pregnancy Inclusion Criteria: - patients with JAK2 V617F positive essential thrombocythemia - age-and sex-matched apparently healthy control subjects Exclusion Criteria: - personal history of any atherosclerotic vascular disease (myocardial infarction, angina pectoris, peripheral arterial disease, aortic disease, transient ischemic attack or ischemic stroke) - chronic kidney disease stage 3 and above - known cancer - chronic inflammatory disease - autoimmune disease - pregnancy Atherosclerosis Atherosclerosis Thrombocytosis Thrombocythemia, Essential 1. Patients and control subjects Patients are selected from the database of the Department of Haematology at University Medical Centre Ljubljana, Slovenia, who were diagnosed with JAK2 V617F positive ET between 2011 and 2014. --- V617F ---

RHI ranges from 1 (no augmentation of pulsation with reactive hyperemia, i.e. worst outcome) to values above 2 (good endothelial response to reactive hyperemia).. Association of the JAK2 V617F mutation burden with the coronary calcium burden.. Quantification of JAK2 V617F mutation burden and its correlation with the coronary calcium burden.. Inclusion Criteria: - patients with JAK2 V617F positive essential thrombocythemia - age-and sex-matched apparently healthy control subjects Exclusion Criteria: - personal history of any atherosclerotic vascular disease (myocardial infarction, angina pectoris, peripheral arterial disease, aortic disease, transient ischemic attack or ischemic stroke) - chronic kidney disease stage 3 and above - known cancer - chronic inflammatory disease - autoimmune disease - pregnancy Inclusion Criteria: - patients with JAK2 V617F positive essential thrombocythemia - age-and sex-matched apparently healthy control subjects Exclusion Criteria: - personal history of any atherosclerotic vascular disease (myocardial infarction, angina pectoris, peripheral arterial disease, aortic disease, transient ischemic attack or ischemic stroke) - chronic kidney disease stage 3 and above - known cancer - chronic inflammatory disease - autoimmune disease - pregnancy Atherosclerosis Atherosclerosis Thrombocytosis Thrombocythemia, Essential 1. Patients and control subjects Patients are selected from the database of the Department of Haematology at University Medical Centre Ljubljana, Slovenia, who were diagnosed with JAK2 V617F positive ET between 2011 and 2014. --- V617F --- --- V617F ---

RHI ranges from 1 (no augmentation of pulsation with reactive hyperemia, i.e. worst outcome) to values above 2 (good endothelial response to reactive hyperemia).. Association of the JAK2 V617F mutation burden with the coronary calcium burden.. Quantification of JAK2 V617F mutation burden and its correlation with the coronary calcium burden.. Inclusion Criteria: - patients with JAK2 V617F positive essential thrombocythemia - age-and sex-matched apparently healthy control subjects Exclusion Criteria: - personal history of any atherosclerotic vascular disease (myocardial infarction, angina pectoris, peripheral arterial disease, aortic disease, transient ischemic attack or ischemic stroke) - chronic kidney disease stage 3 and above - known cancer - chronic inflammatory disease - autoimmune disease - pregnancy Inclusion Criteria: - patients with JAK2 V617F positive essential thrombocythemia - age-and sex-matched apparently healthy control subjects Exclusion Criteria: - personal history of any atherosclerotic vascular disease (myocardial infarction, angina pectoris, peripheral arterial disease, aortic disease, transient ischemic attack or ischemic stroke) - chronic kidney disease stage 3 and above - known cancer - chronic inflammatory disease - autoimmune disease - pregnancy Atherosclerosis Atherosclerosis Thrombocytosis Thrombocythemia, Essential 1. Patients and control subjects Patients are selected from the database of the Department of Haematology at University Medical Centre Ljubljana, Slovenia, who were diagnosed with JAK2 V617F positive ET between 2011 and 2014. --- V617F --- --- V617F --- --- V617F ---

RHI ranges from 1 (no augmentation of pulsation with reactive hyperemia, i.e. worst outcome) to values above 2 (good endothelial response to reactive hyperemia).. Association of the JAK2 V617F mutation burden with the coronary calcium burden.. Quantification of JAK2 V617F mutation burden and its correlation with the coronary calcium burden.. Inclusion Criteria: - patients with JAK2 V617F positive essential thrombocythemia - age-and sex-matched apparently healthy control subjects Exclusion Criteria: - personal history of any atherosclerotic vascular disease (myocardial infarction, angina pectoris, peripheral arterial disease, aortic disease, transient ischemic attack or ischemic stroke) - chronic kidney disease stage 3 and above - known cancer - chronic inflammatory disease - autoimmune disease - pregnancy Inclusion Criteria: - patients with JAK2 V617F positive essential thrombocythemia - age-and sex-matched apparently healthy control subjects Exclusion Criteria: - personal history of any atherosclerotic vascular disease (myocardial infarction, angina pectoris, peripheral arterial disease, aortic disease, transient ischemic attack or ischemic stroke) - chronic kidney disease stage 3 and above - known cancer - chronic inflammatory disease - autoimmune disease - pregnancy Atherosclerosis Atherosclerosis Thrombocytosis Thrombocythemia, Essential 1. Patients and control subjects Patients are selected from the database of the Department of Haematology at University Medical Centre Ljubljana, Slovenia, who were diagnosed with JAK2 V617F positive ET between 2011 and 2014. --- V617F --- --- V617F --- --- V617F --- --- V617F ---

RHI ranges from 1 (no augmentation of pulsation with reactive hyperemia, i.e. worst outcome) to values above 2 (good endothelial response to reactive hyperemia).. Association of the JAK2 V617F mutation burden with the coronary calcium burden.. Quantification of JAK2 V617F mutation burden and its correlation with the coronary calcium burden.. Inclusion Criteria: - patients with JAK2 V617F positive essential thrombocythemia - age-and sex-matched apparently healthy control subjects Exclusion Criteria: - personal history of any atherosclerotic vascular disease (myocardial infarction, angina pectoris, peripheral arterial disease, aortic disease, transient ischemic attack or ischemic stroke) - chronic kidney disease stage 3 and above - known cancer - chronic inflammatory disease - autoimmune disease - pregnancy Inclusion Criteria: - patients with JAK2 V617F positive essential thrombocythemia - age-and sex-matched apparently healthy control subjects Exclusion Criteria: - personal history of any atherosclerotic vascular disease (myocardial infarction, angina pectoris, peripheral arterial disease, aortic disease, transient ischemic attack or ischemic stroke) - chronic kidney disease stage 3 and above - known cancer - chronic inflammatory disease - autoimmune disease - pregnancy Atherosclerosis Atherosclerosis Thrombocytosis Thrombocythemia, Essential 1. Patients and control subjects Patients are selected from the database of the Department of Haematology at University Medical Centre Ljubljana, Slovenia, who were diagnosed with JAK2 V617F positive ET between 2011 and 2014. --- V617F --- --- V617F --- --- V617F --- --- V617F --- --- V617F ---

40 patients (14 male and 26 female) with JAK2 V617F positive ET without clinically apparent cardiovascular disease signed the informed consent and were enrolled in the study in 2014 - 2015 for the first examination and 36 (12 male and 24 female) of them are expected to participate also in 2018-19. --- V617F ---

3. JAK2 V617F/G1849T allele burden The ipsogen JAK2 MutaQuant Kit, Qiagen (ZDA) (Ref: No. 673523) will be used for the detection and quantification of JAK2 V617F/G1849T allele in genomic DNA extracted from peripheral blood of patients and also control subjects. --- V617F ---

3. JAK2 V617F/G1849T allele burden The ipsogen JAK2 MutaQuant Kit, Qiagen (ZDA) (Ref: No. 673523) will be used for the detection and quantification of JAK2 V617F/G1849T allele in genomic DNA extracted from peripheral blood of patients and also control subjects. --- V617F --- --- V617F ---

A SNP specific primer selectively amplifies the JAK2 V617F allele which is detected with a real-time qPCR instrument that quantifies the PCR products. --- V617F ---

The JAK2 V617F allele burden will be calculated and expressed as the percentage of JAK2 V617F mutated alleles throughout the whole JAK2 record. --- V617F ---

The JAK2 V617F allele burden will be calculated and expressed as the percentage of JAK2 V617F mutated alleles throughout the whole JAK2 record. --- V617F --- --- V617F ---

The association between the parameters of vascular function / morphology and the JAK2 V617F allele burden will be assessed by the Pearson correlation coefficient. --- V617F ---

The primary purpose of this study is to measure the response rate in participants with the myeloproliferative neoplasms (MPNs), polycythemia vera (PV), essential thrombocythemia (ET), or myelofibrosis (MF) when treated with LY2784544, including those who have demonstrated an intolerance to, failure of primary response to, or have demonstrated disease progression while on ruxolitinib.

NCT01594723

Conditions

1. Neoplasms, Hematologic

Interventions

1. Drug: 120 mg LY2784544

MeSH:Neoplasms Hematologic Neoplasms Myeloproliferative Disorders

HPO:Hematological neoplasm Leukemia Myeloproliferative disorder Neoplasm

Inclusion Criteria: - Have a diagnosis of polycythemia vera (PV), essential thrombocythemia (ET), or myelofibrosis (MF) as defined by the World Health Organization (WHO) diagnostic criteria for myeloproliferative neoplasms (Swerdlow et al. 2008) and meet the following additional subtype specific criteria: - PV: have failed or is intolerant of standard therapies or refuses to take standard medications - ET: have failed or is intolerant of standard therapies or refuses to take standard medications - MF (participants with MF must meet at least 1 of the following): have intermediate 1, intermediate 2, or high-risk MF according to the Dynamic International Prognostic Scoring System (DIPPS Plus) for Primary Myelofibrosis (Gangat et al. 2011); or have symptomatic MF with spleen greater than 10 centimeter (cm) below left costal margin; or have post-polycythemic MF; or have post-ET MF - All PV, ET, and MF participants must meet the following criteria: o Have a quantifiable level of janus kinase 2 with a valine to phenylalanine substitution at amino acid 617 (JAK2 V617F) mutation. --- V617F ---

This inclusion criterion will not apply to the subset of participants in Cohorts 10 and 11 that must be negative for the JAK2 V617F mutation - Are ≥ 18 years of age - Have given written informed consent prior to any study-specific procedures - Have adequate organ function, including: Hepatic: Direct bilirubin ≤1.5 times upper limits of normal (ULN), alanine transaminase (ALT), and aspartate transaminase (AST) ≤2.5 times ULN; Renal: Serum creatinine ≤1.5 times ULN; Bone Marrow Reserve: Absolute neutrophil count (ANC) ≥1000/microliter (mcL), platelets ≥50,000/mcL for participants with ET or PV and ≥25,000/mcL for participants with MF - Have a performance status of 0, 1, or 2 on the Eastern Cooperative Oncology Group (ECOG) scale - Have discontinued all previous approved therapies for Myeloproliferative Neoplasms (MPNs), including any chemotherapy, immunomodulating therapy (for example, thalidomide, interferon-alpha), immunosuppressive therapy (for example, corticosteroids >10 mg/day prednisone or equivalent), radiotherapy, and erythropoietin, thrombopoietin, or granulocyte colony stimulating factor for at least 14 days and recovered from the acute effects of therapy. --- V617F ---

An exception to this criterion will be allowed for participants with a prior history of Budd-Chiari Syndrome who are being treated with warfarin or one of its derivatives - Have received a hematopoietic stem cell transplant - Have a second primary malignancy that in the judgment of the Investigator and Sponsor may affect the interpretation of results - Have an active fungal, bacterial, and/or known viral infection including human immunodeficiency virus (HIV) or viral (A, B, or C) hepatitis (screening is not required) - Have a history of congestive heart failure with New York Heart Association (NYHA) Class >2 (NYHA Class 1 and 2 are eligible), unstable angina, recent myocardial infarction (within 6 months prior to administration of study drug), or documented history of ventricular arrhythmia Inclusion Criteria: - Have a diagnosis of polycythemia vera (PV), essential thrombocythemia (ET), or myelofibrosis (MF) as defined by the World Health Organization (WHO) diagnostic criteria for myeloproliferative neoplasms (Swerdlow et al. 2008) and meet the following additional subtype specific criteria: - PV: have failed or is intolerant of standard therapies or refuses to take standard medications - ET: have failed or is intolerant of standard therapies or refuses to take standard medications - MF (participants with MF must meet at least 1 of the following): have intermediate 1, intermediate 2, or high-risk MF according to the Dynamic International Prognostic Scoring System (DIPPS Plus) for Primary Myelofibrosis (Gangat et al. 2011); or have symptomatic MF with spleen greater than 10 centimeter (cm) below left costal margin; or have post-polycythemic MF; or have post-ET MF - All PV, ET, and MF participants must meet the following criteria: o Have a quantifiable level of janus kinase 2 with a valine to phenylalanine substitution at amino acid 617 (JAK2 V617F) mutation. --- V617F ---

The purpose of this study is to evaluate the safety and efficacy of the tyrosine kinase inhibitor, imatinib mesylate (Gleevec ) in reducing peripheral blood eosinophilia in patients with the myeloid form of hypereosinophilic syndrome (HES). Patients with the hypereosinophilic syndrome who meet a set of criteria designed to select patients with the myeloid form of the disease, as well as patients without myeloid disease who are refractory to standard therapy for HES, will be admitted on this protocol. A thorough clinical evaluation will be performed with emphasis on potential sequelae of eosinophil-mediated tissue damage. A baseline bone marrow will be obtained to exclude leukemia or lymphoma and to assess the degree and nature of eosinophilopoiesis. Bone marrow, blood cells and/or serum will also be collected to test for the presence of a recently described mutation that is associated with imatinib-responsiveness in HES, and to provide reagents (such as DNA, RNA, and specific antibodies) and for use in the laboratory to address issues related to the mechanism of action of imatinib mesylate in HES. Imatinib mesylate will be initiated at a dose of 400 mg daily, the FDA-approved dose for the treatment of chronic myelogenous leukemia. In patients who demonstrate a complete clinical and hematologic response to imatinib therapy and who do not have life-threatening disease, the dose will be decreased gradually to 100mg daily and then discontinued. In order to minimize bone marrow suppression, other myelosuppressive agents will be tapered and discontinued during the first week of therapy with imatinib mesylate. Complete blood counts will be performed weekly for the first month and biweekly thereafter. Clinical assessments will be performed every three months to assess progression of end organ damage. In patients who demonstrate a complete clinical and hematologic response to imatinib therapy and who do not have life-threatening disease, the dose will be decreased gradually to 100 mg daily and then discontinued. In the event of clinical, hematologic or molecular relapse during the taper, the imatinib dose will be increased to a maximum of 600 mg daily to achieve a second remission. Laboratory monitoring will be performed as above except for molecular monitoring which will be monitored monthly if drug is discontinued or molecular relapse occurs. Once a stable dosing regimen is achieved for greater than or equal to 6 months in subjects who have undergone dose descalation or greater than or equal to 2 years in subjects receiving 300-400 mg of imatinib daily who did not qualify for dose de-escalation, the frequency of NIH visits and end organ assessments will be decreased to 6 months, with molecular monitoring every 3 months and monthly routine laboratory assessments.

NCT00044304

Conditions

1. Eosinophilic Myeloid Neoplasm
2. Hypereosinophilic Syndrome

Interventions

1. Drug: Imatinib
2. Drug: Ruxolitinib

MeSH:Hypereosinophilic Syndrome Syndrome

abnormal tyrosine kinase (i.e., FIP1L1-PDGFRA, JAK2 V617F). --- V617F ---

CYTO-PV is a phase III Prospective, Randomized, Open-label, with Blinded Endpoint evaluation (PROBE), multi-center, clinical trial in patients with diagnosis of Polycythemia vera (PV) treated at the best of recommended therapies (e.g.adequate control of standard cardiovascular risk factors). Irrespective of randomized interventions, all patients will be administered low-dose aspirin (when not contraindicated), i.e.the standard antithrombotic treatment in PV patients. The purpose of this study to demonstrate that a more intensive cytoreductive therapy, plus low-dose aspirin when not contraindicated, with phlebotomy and/or hydroxyurea (HU), aimed at maintaining hematocrit (HCT) < 45% is more effective than a less intensive cytoreduction (either with phlebotomy or HU plus low-dose aspirin when not contraindicated) maintaining HCT in the range of 45-50% in the reduction of CV deaths plus thrombotic events (stroke, acute coronary syndrome [ACS], transient ischemic attack [TIA], pulmonary embolism [PE], splanchnic thrombosis, deep vein thrombosis [DVT], and any other clinically relevant thrombotic event), in patients with Polycythemia Vera treated at the best of recommended therapies (e.g. adequate control of standard cardiovascular risk factors).

NCT01645124

Conditions

1. Polycythemia Vera

Interventions

1. Drug: Hydroxyurea
2. Procedure: Phlebotomy

MeSH:Polycythemia Vera Polycythemia

HPO:Polycythemia

However, both pragmatic reasons and the consideration of the clinical condition under study (see: age, comorbidity, polytherapy) support the decision to adopt a generalized policy of surveillance specifically on: Hypotension or syncope after phlebotomy; renal dysfunction (creatinine); liver dysfunction (ALT, AST, symptoms); White blood cell count; Platelet count; Bleeding.. Inclusion Criteria: Males and females aged 18 years or more are eligible for the study if they meet all the following inclusion criteria: - New diagnosis of PV according to WHO 2007 diagnostic criteria including Jak 2 V617F mutation status; - Old diagnosis of PV confirmed with JAK-2 positivity and clinical course of the disease; - Ability and willingness to comply with all study requirements; - Written informed consent (obtained before any study specific procedure). --- V617F ---

Inclusion Criteria: Males and females aged 18 years or more are eligible for the study if they meet all the following inclusion criteria: - New diagnosis of PV according to WHO 2007 diagnostic criteria including Jak 2 V617F mutation status; - Old diagnosis of PV confirmed with JAK-2 positivity and clinical course of the disease; - Ability and willingness to comply with all study requirements; - Written informed consent (obtained before any study specific procedure). --- V617F ---

The trial will be a phase III, randomised-controlled, multi-centre, international, open-label trial consisting of ruxolitinib versus best available therapy, where best available therapy is a choice of interferon alpha, any formulation permitted (IFN) or hydroxycarbamide (HC), and which will be elected by the Investigator prior to randomisation.

NCT04116502

Conditions

1. Polycythemia Vera

Interventions

1. Drug: Ruxolitinib
2. Drug: Hydroxycarbamide
3. Drug: Interferon-Alpha

MeSH:Polycythemia Vera Polycythemia

HPO:Polycythemia

Peripheral blood JAK2 V617F allele burden. --- V617F ---

Symptom burden/(QALY)quality of life years gained 7. Health economics including cost utility and cost effectiveness analyses 8. Peripheral blood JAK2 V617F allele burden according to ELN response criteria 9. Rates of discontinuation 10. --- V617F ---

This is a multicenter, open label, long-term study testing the long-term safety, tolerability and efficacy of givinostat in patients with Polycythemia Vera, Essential Thrombocythemia, primary Myelofibrosis, Post-Polycythemia Vera Myelofibrosis, Post-Essential Thrombocythemia Myelofibrosis following core protocols in chronic myeloproliferative neoplasms and/or patient-named compassionate use program (if regulated/allowed by the local regulations, e.g. for Italy D.M. 8/5/2003 "Uso terapeutico di medicinale sottoposto a sperimentazione clinica" published on G.U. n. 173 of 28 July 2003, and the following amendments). Patients will continue at their last tolerable dose and treatment schedule of givinostat monotherapy. If patients previously received givinostat in combination with other drugs during a core protocol or a compassionate use program (if regulated/allowed by the local regulations, e.g. for Italy D.M. 8/5/2003 "Uso terapeutico di medicinale sottoposto a sperimentazione clinica" published on G.U. n. 173 of 28 July 2003, and the following amendments), they will be treated at the last tolerable dose of the combination. Assessment of safety and efficacy will be performed at each quarterly visit and each visit will also include laboratory tests and ECG examination. During the visits the clinical benefit will be assessed by Investigator according to the revised European LeukemiaNet response criteria (for PV and ET) and EUMNET response criteria (for MF). The dose of Givinostat will be modified for protocol specified toxicities. The treatment may continue up to Marketing Authorization of givinostat, currently planned in the next 5 years (note: only for Germany, this long-term study is initially limited up to 2 years of treatment). Patients may discontinue study treatment at any time and remain on study therapy as long as they derive clinical benefit. Safety will be monitored at each visit throughout the entire duration of the study. In case the approved label will not cover the whole study population, givinostat will be provided by the Sponsor to those patients not fulfilling the criteria for the approved label of the drug that are still deriving benefit from givinostat at the time of its commercial availability.

NCT01761968

Conditions

1. Chronic Myeloproliferative Neoplasms

Interventions

1. Drug: givinostat

MeSH:Neoplasms Myeloproliferative Disorders

HPO:Myeloproliferative disorder Neoplasm

reduction of the allele burden of the mutated Janus Kinase 2 in the position V617F). --- V617F ---

The goal of this clinical research study is to learn if rigosertib can help to control MF in patients with anemia. The safety of this drug will also be studied. This is an investigational study. Rigosertib is not FDA-approved or commercially available. It is currently being used for research purposes only. The study doctor can explain how the study drug is designed to work. Up to 35 participants will be enrolled in this study. All will be enrolled at MD Anderson.

NCT02730884

Conditions

1. Leukemia
2. Myelofibrosis
3. Anemia
4. Splenomegaly

Interventions

1. Drug: Rigosertib
2. Behavioral: Questionnaire

MeSH:Anemia Primary Myelofibrosis Splenomegaly

HPO:Anemia Splenomegaly

Measurement of JAK2 V617F allele burden in Bone Marrow (BM) samples, if not done within 6 months prior to Screening, must be provided with the Screening BM biopsy/aspirate report (patients are eligible regardless of JAK2 mutation status); 3. Anemia or RBC-transfusion dependence defined as follows: a) Anemia: defined for the purpose of this protocol as 1) a hemoglobin level <10 g/L on every determination over 84 days before study-entry, without red blood cell (RBC)-transfusions, or 2) a hemoglobin level <10 g/L on a patient that is receiving RBC-transfusions periodically but not meeting criteria for transfusion-dependent patient as defined below. --- V617F ---

This is an 18-week open-label, multicenter study to evaluate the efficacy and tolerability of CEP-701 (lestaurtinib) treatment in patients with Polycythemia Vera (PV) and patients with Essential Thrombocytosis (ET).

NCT00586651

Conditions

1. Polycythemia Vera
2. Essential Thrombocytosis

Interventions

1. Drug: lestaurtinib

MeSH:Polycythemia Vera Polycythemia Thrombocytosis Thrombocythemia, Essential

HPO:Polycythemia Thrombocytosis

An Open-Label Study of Oral CEP-701 in Patients With Polycythemia Vera or Essential Thrombocytosis With the JAK2 V617F Mutation. --- V617F ---

Determine whether a specific reduction in the JAK2 V617F allele has been indicated in this study.. null. --- V617F ---

- The patient has a detectable JAK2 V617F mutation. --- V617F ---

The purpose of the study is to compare the efficacy and toxicity including quality of life of two types of low-dose interferon alpha compounds (PegIntron and Pegasys) with hydroxyurea (Hydrea), and to investigate the occurence of neutralizing antibodies against recombinant interferon.

NCT01387763

Conditions

1. Polycythemia Vera
2. Essential Thrombocythemia
3. Primary Myelofibrosis

Interventions

1. Drug: PegIntron
2. Drug: Pegasys
3. Drug: PegIntron
4. Drug: Pegasys
5. Drug: Hydrea

MeSH:Neoplasms Polycythemia Vera Primary Myelofibrosis Polycythemia Thrombocytosis Thrombocythemia, Essential

HPO:Neoplasm Polycythemia Thrombocytosis

Molecular responses (JAK V617F allele burden) are assessed by qPCR according to the ELN guidelines.. toxicity (discontinuation of therapy due to intolerability). --- V617F ---

In 2005 major breakthrough in our understanding of the molecular pathophysiology was achieved with the identification of the JAK2 V617F mutation which is present in almost all patients with PV (98%) and about half of patients with ET and PMF. --- V617F ---

Within recent years IFN-alpha has demonstrated a capacity of inducing deep molecular remission (evaluated by JAK2 V617F qPCR) and normalisation of bone marrow morphology. --- V617F ---

If patients have a sustained deep molecular response (below 1 % JAK2 V617F mutated alleles for 12 months) therapy will be stopped to asses the sustainability of the remission off therapy.Patients over the age of 75 and intolerant or resistant to hydroxyurea will be offered rescue treatment with orally busulfan (Myleran). --- V617F ---

Myelofibrosis is the gradual replacement of bone marrow (place where most new blood cells are produced) by fibrous tissue which reduces the body's ability to produce new blood cells and results in the development of chronic anemia (low red blood cell count). One of the main distinctions of myelofibrosis is "extramedullary hematopoesis", the migration or traveling of the blood-forming cells out of the bones to other parts of the body, such as the liver or spleen, resulting in an enlarged spleen and liver. Treatment for myelofibrosis is unsatisfactory and there is no medication that is specifically used in the treatment of myelofibrosis. There is a protein that is found to be present in the majority of myelofibrosis patients (JAK2) and the drug Lestaurtinib is being studied to see if it will stop this protein from functioning and thereby help control the disease. This study is divided into two Phases (1 & 2). In phase 1 we will be looking for the dose of study medication (Lestaurtinib) that will be the highest dose a patient can take without experiencing serious side effects, maximum tolerated dose (MTD). In phase 2, after the MTD dose has been established in phase 1, we will be investigating how well CEP-701 (Lestaurtinib) works at suppressing the protein (JAK2). The investigators also wish to find out important biologic characteristics or features of myelofibrosis through an additional correlative biomarker study (MPD-RC #107). The correlative biomarker study is a study that is related to the main study, but is looking to answer different questions than the main study. The purpose of the biomarker study is to understand the causes of MPD and to develop improved methods for the diagnosis and treatment of these diseases, while the main study is trying to find out how well CEP-701 (Lestaurtinib) will work in treating the myeloproliferative disease.

NCT00668421

Conditions

1. Myelofibrosis
2. Essential Thrombocythemia
3. Polycythemia Vera

Interventions

1. Drug: CEP-701 (Lestaurtinib)

MeSH:Polycythemia Vera Primary Myelofibrosis Polycythemia Thrombocytosis Thrombocythemia, Essential

HPO:Polycythemia Thrombocytosis

To estimate the efficacy of a novel kinase inhibitor in subjects with myelofibrosis, as determined by a reduction in JAK2 V617F allele frequency in peripheral blood neutrophils.. null. --- V617F ---

3. The subject has a detectable JAK2 V617F mutation. --- V617F ---

The purpose of this study is to find out the safe dose range of the study drug in patients with myeloproliferative disorders.

NCT01134120

Conditions

1. Myeloproliferative Disorders
2. Thrombocythemia, Essential
3. Polycythemia Vera
4. Primary Myelofibrosis

Interventions

1. Drug: LY2784544

MeSH:Polycythemia Vera Primary Myelofibrosis Polycythemia Thrombocytosis Myeloproliferative Disorders Thrombocythemia, Essential

HPO:Myeloproliferative disorder Polycythemia Thrombocytosis

A Phase 1 Study of LY2784544 in Patients With JAK2 V617F-Positive Myeloproliferative Disorders. --- V617F ---

has post-ET MF - Have a quantifiable JAK2 V617F mutation - Have discontinued all previous approved therapies for myeloproliferative disorders, including any chemotherapy, immunomodulating therapy (for example, thalidomide, interferon-alpha), immunosuppressive therapy (for example, corticosteroids greater than 10 mg/day prednisone or equivalent), radiotherapy, and erythropoietin, thrombopoietin, or granulocyte colony stimulating factor for at least 14 days and recovered from the acute effects of therapy. --- V617F ---

This is a phase 1, multicenter, open-label study evaluating the safety and efficacy of ruxolitinib, steroids and lenalidomide among MM patients who currently show progressive disease.

NCT03110822

Conditions

1. Multiple Myeloma

Interventions

1. Drug: Ruxolitinib Oral Tablet [Jakafi]
2. Drug: Lenalidomide
3. Drug: Methylprednisolone

MeSH:Multiple Myeloma Neoplasms, Plasma Cell

HPO:Multiple myeloma

The activating JAK2 V617F mutation results in uncontrolled cytokine and growth factor signaling, and is believed to play a key role in the pathophysiology of myeloproliferative neoplasms. --- V617F ---

Phase 1 open-label study to estimate the safety, manufacturing feasibility, and efficacy of intravenously administered, lentivirally transduced T cells expressing anti-CD123 chimeric antigen receptors expressing tandem TCRζ and 4-1BB (TCRζ /4-1BB) costimulatory domains in pediatric subjects with relapsed/refractory Acute Myeloid Leukemia (AML).

NCT04678336

Conditions

1. Acute Myeloid Leukemia, in Relapse
2. Acute Myeloid Leukemia, Pediatric
3. Acute Myeloid Leukemia, Refractory

Interventions

1. Biological: CART123 cells; cyclophosphamide; fludarabine

MeSH:Leukemia Leukemia, Myeloid Leukemia, Myeloid, Acute

HPO:Acute megakaryocytic leukemia Acute myeloid leukemia Leukemia Myeloid leukemia

Patients with somatic JAK2 V617F mutation by PCR or next generation sequencing. --- V617F ---

The primary objective of this study is to determine the overall response rate to erlotinib in patients with polycythemia vera (PV). Response rate will be assessed by improvement in the complete blood count, ultrasound of the spleen, and JAK2 molecular status. It is purposed in this study to explore a possible molecular targeting of the driving mechanism of PV.

NCT01038856

Conditions

1. Polycythemia Vera

Interventions

1. Drug: Erlotinib

MeSH:Polycythemia Vera Polycythemia

HPO:Polycythemia

Phase II Trial of Erlotinib in Patients With JAK-2 V617F Positive Polycythemia Vera. --- V617F ---

Trial of Erlotinib in Patients With JAK-2 V617F Positive Polycythemia Vera The primary objective of this study is to determine the overall response rate to erlotinib in patients with polycythemia vera (PV). --- V617F ---

This is a Phase II, multicenter, open-label, single arm, 2-stage study of tazemetostat 800 mg BID (twice daily) and 1600 mg QD (once daily). Subjects will be screened for eligibility within 21 days of the planned date of the first dose of tazemetostat and enrolled into one of 8 cohorts: Cohort using tazemetostat 800 mg BID - Cohort 1 (Closed for enrollment): MRT, RTK, ATRT, and selected tumors with rhabdoid features, including small cell carcinoma of the ovary hypercalcemic type [SCCOHT], also known as malignant rhaboid tumor of the ovary [MRTO] - Cohort 2 (Closed for enrollment): Relapsed or refractory synovial sarcoma with SS18-SSX rearrangement - Cohort 3 (Closed for enrollment): Other INI1 negative tumors or any solid tumor with an EZH2 gain of function (GOF) mutation, including: epithelioid malignant peripheral nerve sheath tumor (EMPNST), extraskeletal myxoid chondrosarcoma (EMC), myoepithelial carcinoma, other INI1-negative malignant tumors with Sponsor approval (e.g., dedifferentiated chordoma) any solid tumor with an EZH2 GOF mutation including but not limited to Ewing's sarcoma and melanoma - Cohort 4 (Closed for enrollment): Renal medullary carcinoma (RMC) - Cohort 5 (Closed for enrollment): Epithelioid sarcoma (ES) - Cohort 6 (Opened for enrollment): Epithelioid sarcoma (ES) undergoing mandatory tumor biopsy - Cohort 7 (Opened for enrollment): Poorly differentiated chordoma (or other chordoma with Sponsor approval) Cohort using tazemetostat 1600 mg QD • Cohort 8 (Opened for enrollment): Epitheliod sarcoma Subjects will be dosed in continuous 28-day cycles. (Note: if treatment with study drug is discontinued prior to completing 2 years, subjects will be followed for a maximum duration of 2 years from start of study drug dosing.) Response assessment will be performed every 8 weeks while on study. Treatment with tazemetostat will continue until disease progression, unacceptable toxicity or withdrawal of consent, or termination of the study.

NCT02601950

Conditions

1. Malignant Rhabdoid Tumors (MRT)
2. Rhabdoid Tumors of the Kidney (RTK)
3. Atypical Teratoid Rhabdoid Tumors (ATRT)
4. Selected Tumors With Rhabdoid Features
5. Synovial Sarcoma
6. INI1-negative Tumors
7. Malignant Rhabdoid Tumor of Ovary
8. Renal Medullary Carcinoma
9. Epithelioid Sarcoma
10. Poorly Differentiated Chordoma (or Other Chordoma With Sponsor Approval)
11. Any Solid Tumor With an EZH2 GOF Mutation

Interventions

1. Drug: Tazemetostat

MeSH:Neoplasms Sarcoma Sarcoma, Synovial Rhabdoid Tumor Chordoma Carcinoma, Medullary Kidney Neoplasms

HPO:Chordoma Neoplasm Renal neoplasm Sarcoma Soft tissue sarcoma Synovial sarcoma

JAK2 V617F) observed in cytogenetic testing and DNA sequencing. --- V617F ---

This is a Phase I, open-label, dose escalation and dose expansion study with BID (suspension) and TID (tablet) oral dose of tazemetostat. Subjects will be screened for eligibility within 14 days of the planned first dose of tazemetostat. A treatment cycle will be 28 days. Response assessment will be evaluated after 8 weeks of treatment and subsequently every 8 weeks while on study. The study has two parts: Dose Escalation and Dose Expansion. Dose escalation for subjects with the following relapsed/refractory malignancies: - Rhabdoid tumors: - Atypical teratoid rhabdoid tumor (ATRT) - Malignant rhabdoid tumor (MRT) - Rhabdoid tumor of kidney (RTK) - Selected tumors with rhabdoid features - INI1-negative tumors: - Epithelioid sarcoma - Epithelioid malignant peripheral nerve sheath tumor - Extraskeletal myxoid chondrosarcoma - Myoepithelial carcinoma - Renal medullary carcinoma - Other INI1-negative malignant tumors (e.g., dedifferentiated chordoma) (with Sponsor approval) - Synovial Sarcoma with a SS18-SSX rearrangement Dose Expansion at the MTD or the RP2D - Cohort 1 -(closed to enrollment) ATRT - Cohort 2 - MRT/RTK/selected tumors with rhabdoid features - Cohort 3 - INI-negative tumors: - Epithelioid sarcoma - Epithelioid malignant peripheral nerve sheath tumor - Extraskeletal myxoid chondrosarcoma - Myoepithelial carcinoma - Renal medullary carcinoma - Chordoma (poorly differentiated or de-differentiated) - Other INI1-negative malignant tumors (e.g., dedifferentiated chordoma) with Sponsor approval - Cohort 4 -(closed to enrollment) Tumor types eligible for Cohorts 1 through 3 or synovial sarcoma with SS18-SSX rearrangement

NCT02601937

Conditions

1. Rhabdoid Tumors
2. INI1-negative Tumors
3. Synovial Sarcoma
4. Malignant Rhabdoid Tumor of Ovary

Interventions

1. Drug: Tazemetostat

MeSH:Neoplasms Sarcoma Sarcoma, Synovial Rhabdoid Tumor

HPO:Neoplasm Sarcoma Soft tissue sarcoma Synovial sarcoma

JAK2 V617F) observed in cytogenetic testing and DNA sequencing. --- V617F ---

This study included 76 newly diagnosed RA patients and 50 matched controls. Basal JAK2 mutation was assessed by PCR in blood samples, TNF-α and IL 6 were measured by ELISA in serum of patients and controls. All patients started therapy with conventional synthetic DMARDs (including methotrexate). Response assessment at 3rd month was evaluated by DAS28 and ACR response criteria. JAK2 mutation was correlated with different clinical and laboratory parameters of patients.

NCT04667988

Conditions

1. Response Assessment in Newly Diagnosed RA Patients at 3rd Month Was Evaluated by DAS28 and ACR in Relation to JAK Expression

Interventions

1. Diagnostic Test: JAK expression

MeSH:Arthritis Arthritis, Rheumatoid

HPO:Arthritis Polyarticular arthritis Rheumatoid arthritis

Impact of pretreatment JAK2 mutation on response of Rheumatoid Arthritis patients to first line csDMARDS.. Inclusion Criteria: - New case RA patients - good liver and renal function Exclusion Criteria: - Other autoimmune diss - Malignancy - Active viral infection - pregnancy and lactation Inclusion Criteria: - New case RA patients - good liver and renal function Exclusion Criteria: - Other autoimmune diss - Malignancy - Active viral infection - pregnancy and lactation Response Assessment in Newly Diagnosed RA Patients at 3rd Month Was Evaluated by DAS28 and ACR in Relation to JAK Expression Arthritis Arthritis, Rheumatoid PCR detection of the JAK-2 V617F mutation using ASO specific PCR Genetic marker: The detection of jak2 V617F mutation were done by using the following primers (JAK2 Reverse: 5' CTGAATAGTCCTACAGTGTTTTCAGTTTCA 3', JAK2 Forward (specific): 5' AGCATTTGGTTTTAAATTATGGAGTATATT 3' and JAK2 Forward (internal control): 5' ATCTATAGTCATGCTGAAAGTAGGAGAAAG 3'). --- V617F ---

Impact of pretreatment JAK2 mutation on response of Rheumatoid Arthritis patients to first line csDMARDS.. Inclusion Criteria: - New case RA patients - good liver and renal function Exclusion Criteria: - Other autoimmune diss - Malignancy - Active viral infection - pregnancy and lactation Inclusion Criteria: - New case RA patients - good liver and renal function Exclusion Criteria: - Other autoimmune diss - Malignancy - Active viral infection - pregnancy and lactation Response Assessment in Newly Diagnosed RA Patients at 3rd Month Was Evaluated by DAS28 and ACR in Relation to JAK Expression Arthritis Arthritis, Rheumatoid PCR detection of the JAK-2 V617F mutation using ASO specific PCR Genetic marker: The detection of jak2 V617F mutation were done by using the following primers (JAK2 Reverse: 5' CTGAATAGTCCTACAGTGTTTTCAGTTTCA 3', JAK2 Forward (specific): 5' AGCATTTGGTTTTAAATTATGGAGTATATT 3' and JAK2 Forward (internal control): 5' ATCTATAGTCATGCTGAAAGTAGGAGAAAG 3'). --- V617F --- --- V617F ---

This research is being done to see if the drug ruxolitinib is effective in reducing the symptoms caused by low-risk essential thrombocythemia (ET) and polycythemia vera (PV). - This research study involves the study drug Ruxolitinib.

NCT04644211

Conditions

1. Essential Thrombocythemia
2. Polycythemia Vera

Interventions

1. Drug: Ruxolitinib

MeSH:Polycythemia Vera Polycythemia Thrombocytosis Thrombocythemia, Essential

HPO:Polycythemia Thrombocytosis

Exclusion Criteria: - Essential thrombocythemia patients who are high risk by IPSET-R criteria (age > 60 with JAK2 V617F mutation and/or history of thrombosis).1 Polycythemia vera patients who are high risk by NCCN guidelines (age > 60 and/or history of thrombosis). --- V617F ---

Natural Killer cells (NK) are pivotal cells of innate immunity, that sense defective expression of HLA class I molecules and are complementary to specific cytotoxic T lymphocytes. A defect in NK cell cytotoxicity has been described in some hematopoietic malignancies such as acute myeloid leukemia, multiple myeloma, myelodysplastic syndroms. This defect is at least partially linked to a decreased or absent expression of some activating NK cell molecules, more particularly the so-called Natural Cytotoxicity Receptors (NCRs) NKp30, NKp44 and NKp46. Some old publications have demonstrated defective NK cytotoxicity in myeloproliferative syndroms (chronic myeloid leukemia, primary thrombocytosis, polycythemia vera). The investigators more particularly focused their attention on polycythemia vera (Vaquez's disease), a myeloproliferative disease characterized by the recently describet mutation V617F of the JAK2 tyrosine kinase. The investigators will precise the mechanisms leading to this cytotoxicity defect, the investigators also will evaluate the implication of V617F mutation on NK physiology, and will study the interactions between NK cells and hematopoietic progenitors.

NCT01284712

Conditions

1. Polycythemia Vera

Interventions

1. Biological: blood sample

MeSH:Polycythemia Vera Polycythemia

HPO:Polycythemia

The investigators more particularly focused their attention on polycythemia vera (Vaquez's disease), a myeloproliferative disease characterized by the recently describet mutation V617F of the JAK2 tyrosine kinase. --- V617F ---

The investigators will precise the mechanisms leading to this cytotoxicity defect, the investigators also will evaluate the implication of V617F mutation on NK physiology, and will study the interactions between NK cells and hematopoietic progenitors. --- V617F ---

Primary Objective: To evaluate efficacy and safety of ITF2357 in the treatment of patients with JAK2V617F positive myeloproliferative diseases [Polycythemia Vera (PV), Essential Thrombocytosis (ET), Myelofibrosis (MF)]. Efficacy was evaluated by ad hoc haematological and clinical criteria for PV and ET, and by internationally established response criteria (EUMNET criteria) for MF. Safety was evaluated by number of subjects experiencing an Adverse Event (AE), type, frequency, severity, timing and relatedness of AEs, including changes in vital signs and clinical laboratory results. Secondary Objective: To evaluate the JAK2 mutated allele burden by quantitative Real-Time Polymerase Chain Reaction (qRTPCR).

NCT00606307

Conditions

1. Myeloproliferative Diseases

Interventions

1. Drug: ITF2357

MeSH:Myeloproliferative Disorders

HPO:Myeloproliferative disorder

A Phase IIA Study of the Histone-deacetylase Inhibitor ITF2357 in Patients With JAK-2 V617F Positive Chronic Myeloproliferative Diseases. --- V617F ---

Phase IIA Study of the HDAC Inhibitor ITF2357 in Patients With JAK-2 V617F Positive Chronic Myeloproliferative Diseases Primary Objective: To evaluate efficacy and safety of ITF2357 in the treatment of patients with JAK2V617F positive myeloproliferative diseases [Polycythemia Vera (PV), Essential Thrombocytosis (ET), Myelofibrosis (MF)]. --- V617F ---

A serious AE (SAE) is defined as an untoward (unfavourable) medical occurrence that at any dose results in death, or is life-threatening or requires inpatient hospitalisation or prolongation of existing hospitalisation, or results in persistent or significant disability/incapacity or is a congenital anomaly/birth defect.. Inclusion Criteria: - Signed Informed Consent Form - Male or female, age ≥ 18 years - Confirmed diagnosis of PV/ET/MF according to the revised World Health Organisation criteria - JAK-2 V617F positivity - In need of cytoreductive therapy when hydroxyurea is not indicated (e.g. --- V617F ---

positive serology IgM) - Known HIV infection - Active hepatitis B and/or C infection - History of other disease, metabolic dysfunction, physical examination finding, or clinical laboratory finding giving reasonable suspicion of a disease or condition that contraindicates use of an investigational drug or that might affect interpretation of the results of the study or render the subject at high risk from treatment complications - Eastern Cooperative Oncology Group (ECOG) performance status 3 or greater - Platelets count <100x109/L within 14 days before enrolment - Absolute neutrophil count <1.2x109/L within 14 days before enrolment - Percentage of blast cells in peripheral blood >10% within 14 days before enrolment - Serum creatinine >2xULN (Upper limit of normal) - Total serum bilirubin >1.5xULN - Serum AST (aspartate aminotransferase) / ALT (alanine aminotransferase) > 3xULN - Interferon alpha within 14 days before enrolment - Hydroxyurea within 14 days before enrolment - Anagrelide within 7 days before enrolment - Any other investigational drug within 28 days before enrolment Inclusion Criteria: - Signed Informed Consent Form - Male or female, age ≥ 18 years - Confirmed diagnosis of PV/ET/MF according to the revised World Health Organisation criteria - JAK-2 V617F positivity - In need of cytoreductive therapy when hydroxyurea is not indicated (e.g. --- V617F ---

Background & Aims: Non-cirrhotic portal hypertension (NCPH) represents a relatively infrequent group of conditions. This work aimed at determining causes of NCPH and evaluating the role of some clinical, laboratory, imaging and endoscopic parameters in prediction of variceal bleeding in an Egyptian cohort with NCPH. Methods: Sixty patients with non-cirrhotic portal hypertension and oesophageal varices were included. All underwent complete clinical evaluation, laboratory investigations, Color Doppler ultrasonography, platelet count/spleen diameter (mm) ratio and upper gastrointestinal endoscopy. Patients were classified into two groups according to variceal bleeding: (1) Group I: twenty six patients with history of bleeding or had an attack of bleeding during one year follow-up; and (2) Group II: thirty four patients without bleeding.

NCT02635815

Conditions

1. Portal Hypertension

Interventions

1. Procedure: Upper gastrointestinal endoscopy

MeSH:Hypertension, Portal Hypertension

HPO:Hypertension Portal hypertension

It was done only for patients with Budd-Chiari syndrome and extrahepatic portal vein thrombosis: anticardiolipin antibodies, lupus anticoagulant, antinuclear antibodies, protein C, S, antithrombin III, factor V Leiden G1691A mutation, prothrombin gene G20210A mutation, methylene tetrahydrofolate reductase C677T mutation by PCR, Janus tyrosine kinase-2 (JAK II) V617F mutation by PCR (to exclude myeloproliferative disorders) and flow cytometry for CD55 and CD59 (to exclude paroxysmal nocturnal hemoglobinuria); (4) Abdominal ultrasonography: for liver size, echogenicity, spleen size, portal vein diameter and ascites; (5) Color Doppler ultrasonographic study: was done in the morning after an overnight fasting using a color Doppler unit with a 3.5 MHz convex probe for confirmation of portal vein (PV) patency and diameter, mean PV flow velocity (mean PVV) (cm/sec), PV direction of flow, splenic vein patency and diameter, presence of portosystemic collaterals and patency of hepatic veins; (6) Platelet count/spleen diameter ratio: calculated as: platelet count/ maximum spleen bipolar diameter by ultrasound in mm; (7) Ultrasonography guided liver biopsy: for diagnosis of NCPH and exclusion of cirrhotic portal hypertension; and (8) Upper gastrointestinal endoscopy using the Pentax video endoscope EG 3440. --- G1691A --- --- G20210A --- --- C677T --- --- V617F ---

This phase I trial studies the side effects and best dose of arsenic trioxide with or without ascorbic acid in treating patients with myelofibrosis. Drugs used in chemotherapy, such as arsenic trioxide, work in different ways to stop the growth of cancer cells, either by killing the cells, by stopping them from dividing, or by stopping them from spreading. Giving arsenic acid together with ascorbic acid may kill more cancer cells.

NCT01014546

Conditions

1. Essential Thrombocythemia
2. Polycythemia Vera
3. Primary Myelofibrosis

Interventions

1. Drug: Arsenic Trioxide
2. Dietary Supplement: Ascorbic Acid
3. Other: Laboratory Biomarker Analysis
4. Other: Pharmacological Study

MeSH:Polycythemia Vera Primary Myelofibrosis Polycythemia Thrombocytosis Thrombocythemia, Essential

HPO:Polycythemia Thrombocytosis

To estimate the efficacy of arsenic trioxide with ascorbic acid in subjects with myelofibrosis, as determined by a reduction in Janus kinase 2 (JAK2) V617F, JAK22T875N, and mutations of the thrombopoietin receptor (MPL515L/K) allele frequency in peripheral blood neutrophils. --- V617F ---

This is an extension study after completion of Phase 2 single arm study to investigate efficacy and safety of P1101 for adult Japanese patients with PV.

NCT04655092

Conditions

1. Polycythemia Vera (PV)

Interventions

1. Biological: P1101 (Rropeginterferon alfa-2b)

MeSH:Polycythemia Vera Polycythemia

HPO:Polycythemia

Changes in JAK2 V617F mutant allelic burden value every 52 weeks over time. --- V617F ---