Primary Outcomes

Description: Total CAPS severity score range is 0-136. Higher values represent a worse outcome (i.e. greater severity of posttraumatic symptoms). CAPS consists of 3 subscales, which are combined to form a total severity score. Subscales: CAPS cluster B (reexperiencing symptoms, range 0-40) CAPS cluster C (avoidance and numbing symptoms, range 0-56) CAPS cluster D (hyperarousal symptoms, range 0-40)

Measure: Clinician Administered PTSD Scale(CAPS)

Time: Immediately following treatment

---

Description: Total CAPS severity score range is 0-136. Higher values represent a worse outcome (i.e. greater severity of posttraumatic symptoms). CAPS consists of 3 subscales, which are combined to form a total severity score. Subscales: CAPS cluster B (reexperiencing symptoms, range 0-40) CAPS cluster C (avoidance and numbing symptoms, range 0-56) CAPS cluster D (hyperarousal symptoms, range 0-40)

Measure: Clinician Administered PTSD Scale(CAPS)

Time: 6-months follow-up

---

Secondary Outcomes

Description: Structured Clinical Interview for DSM-IV - Major Depressive Disorder is a clinical interview to assess presence/absence of Major Depressive Disorder.

Measure: Structured Clinical Interview for DSM-IV - Major Depressive Disorder (SCID-MDD)

Time: Immediately following treatment

---

Primary Outcomes

Measure: symptoms of Posttraumatic Stress Disorder-Clinician Administered PTSD Scale(CAPS) and PCL

Time: At initial assessment, during treatment, immediately following treatment, and 6 months after completion of treatment

---

Secondary Outcomes

Measure: Other measures include BDI, BSI, STAXI-2, Expectancy of Therapeutic Outcomes

Time: At initial assessment, during treatment, immediately following treatment, and 6 months after completion of treatment

---

Primary Outcomes

Measure: Efficacy of quetiapine as a treatment for acute mania and depression, and of as a manutence treatment.

Time: 16 weeks

---

Secondary Outcomes

Measure: Assess the pharmacodynamics of quetiapine by neurotrophins in blood samples.

Time: 16 weeks

---

Primary Outcomes

Measure: Hamilton depression raing scale and young mania rating scale

Time: 16 weeks

---

Secondary Outcomes

Measure: Serum BDNF levels as predictor of response to treatment

Time: 16 weeks

---

Primary Outcomes

Measure: Cognitive deficits in BD patients are associated with COMT, ApoE and BDNF polymorphisms

Time: 18 months

---

Primary Outcomes

Description: Synaptic plasticity or LTD will be measured using the MEP in response to stimulation set at 80% of the active motor threshold. This MEP will be measured at 90 minutes after study drug dose to establish baseline MEP amplitude then LTD will be induced with the cTBS procedure. The amount of LTD remaining at the different time points, post-cTBS will be quantified by measuring the MEPs and dividing it by the baseline MEP. This will yield a percent of baseline MEP at the various time points.

Measure: percent of baseline TMS-induced measures of (1) human synaptic plasticity (LTD)

Time: at 90 minutes after study drug dose

---

Primary Outcomes

Description: Clinician Administered PTSD Scale (CAPS) for the DSM-IV [34]. The CAPS-IV is a structured clinical interview designed to assess the 17 DSM-IV PTSD symptoms. CAPS-IV provides categorical ratings of diagnostic status as well as a quantitative index of symptom severity. The CAPS total severity score is based on response to the 17 items that assess the frequency and intensity of current PTSD symptoms. Symptom severity is assessed separately for past month and past week time frames. CAPS-IV range is 0-136, higher scores mean a worse outcome.

Measure: CAPS-IV at the End of Treatment

Time: after weekly treatment session 9 (at posttreatment assessment)

---

Primary Outcomes

Measure: Change in walking symmetry

Time: before and after 8 weeks of therapy

---

Secondary Outcomes

Measure: Change in walking speed

Time: before and after 8 weeks of therapy

---

Measure: Change in excitability of neural motor pathways

Time: before and after 8 weeks of therapy

---

Measure: Change in patient/parent satisfaction rating

Time: before and after 8 weeks of therapy

---

Measure: Change in community step activity

Time: before and after 8 weeks of therapy

---

Other Outcomes

Measure: Changes in walking ability and cortical excitability measures (detailed above)

Time: before and after a 4 week baseline phase; before and after a 4 week withdraw phase

---

Primary Outcomes

Measure: Change from baseline in the motor evoked potential (MEP) amplitude at S50 after 30 minutes from rPAS (T30).

Time: 30 minutes from rPAS

---

Primary Outcomes

Measure: Blood-oxygen-level dependent (BOLD) responses during the Real-Time Neurofeedback Task.

Time: BOLD responses will be assessed at baseline and depression severity will be assessed at baseline

---

Secondary Outcomes

Measure: Depression severity assessed with several depressive questionnaires.

Time: Every two weeks until the end of the trial (16 weeks total), or until the participants leave the study.

---

Other Outcomes

Description: Affect processing: Emotional Words Task and Facial Emotion Perception test. Attention and Inhibitory Control: Parametric Go/NoGo, Trail Making test and the Stroop Color Word test . Inferential Reasoning (including cost-benefit analysis): Delayed Discounting of Money Rewards, Iowa Gambling Task, Common Difference effect gambling task and the WCST.

Measure: Neuropsychological functioning of patients with depression

Time: At baseline

---

Description: 5ml of blood drawn per participants will be used for genotyping

Measure: BDNF Val66Met single nucleotide polymorphism(SNP)genotyping

Time: At baseline

---

Primary Outcomes

Description: A computer quantified tracking performance measure in each test. This is a calculation of accuracy by using the equation: AI = 100(P-E)/P. Where E is the root mean square (r.m.s.) error between the target line and the response line, and P is the size of the individual's target pattern, calculated as the r.m.s. difference between the sine wave and the midline separating the upper and lower phases of the sine wave. The magnitude of P is determined by the scale of the vertical axis, which is the subject's range of finger motion. Therefore, the AI is normalized to each subject's own range of motion and takes into account any differences between subjects in the excursion of the tracking target. The maximum possible score is 100%. Negative scores occur when the response line is so distant from the target that it falls on the opposite side of the midline.

Measure: Accuracy Index

Time: Day 1: posttest after training

---

Secondary Outcomes

Description: Cortical excitability will be measured with transcranial magnetic stimulation (TMS) single and paired pulse stimulation to measure short-interval intracortical inhibition (SICI), cortical silent period (CSP) and motor evoked potential (MEP) amplitude.

Measure: Cortical Excitability

Time: Day 1: baseline

---

Description: Cortical excitability will be measured with transcranial magnetic stimulation (TMS) single and paired pulse stimulation to measure short-interval intracortical inhibition (SICI), cortical silent period (CSP) and motor evoked potential (MEP) amplitude.

Measure: Cortical Excitability

Time: Day 1: posttest

---

Other Outcomes

Description: BDNF genetic variant screening will be conducted via saliva sample collected at the end of the session on day 1. We will screen for the Val66met polymorphism.

Measure: BDNF genetic status

Time: Day 1

---

Primary Outcomes

Description: Recall score immediately after learning phase (=training of visual-spatial abilities) under tDC stimulation + SSRI application compared to learning under tDC stimulation + placebo.

Measure: Recall score after learning under tDC stimulation + SSRI compared to learning under tDC stimulation + placebo.

Time: immediately after end of learning phase (approx. 1 hour)

---

Secondary Outcomes

Description: Measurement of recall scores on the evening of the same day after the learning phase (+tDCS + SSRI), the morning of the day after and 1 week later in order to assess the prolongation of atDCS induced learning enhancement by the SSRI.

Measure: prolongation of the atDCS induced learning enhancement by SSRI

Time: 1 week

---

Description: Measurement of recall scores directly after learning phase after application of atDCS + placebo or sham-tDCS + SSRI vs. sham-tDCS + placebo.

Measure: Increase of learning enhancement by atDCS + placebo or sham-tDCS + SSRI vs. sham-tDCS + placebo

Time: immediately after learning phase (approx. 1 hour)

---

Description: Measurement of recall scores on the evening of the same day of learning phase, the morning of the day after and 1 week later under application of atDCS + placebo or sham-tDCS + SSRI vs. sham-tDCS + placebo, in order to assess prolongation of learning enhancement by SSRI.

Measure: prolongation of learning enhancement by atDCS + placebo or sham-tDCS + SSRI vs. sham-tDCS + placebo

Time: 1 week

---

Description: To assess predictors of SSRI-enhanced brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF, Val66Met, COMT, Val158Met, KIBRA, rs17070145, 5-Hydroxytryptamine transporter).

Measure: genotyping of learning related polymorphisms

Time: once

---

Primary Outcomes

Description: Investigation whether the combination of intensive visual-spatial training (LOCATO task) and tDCS leads to improvement of visual-spatial learning and memory measured by performance in LOCATO task after end of a 3 day period of training compared to sham stimulation.

Measure: Performance in LOCATO task (Visual-spatial learning and memory) after a combination of intensive visual-spatial training and tDCS

Time: immediately after end of a 3-day period of training in tDCS condition vs sham condition

---

Secondary Outcomes

Description: long term effects measured by performance in LOCATO task in tDCS condition after end of cognitve training and after 1 month compared to control conditions

Measure: long term effects

Time: after 1 month vs baseline

---

Description: Connectivity (measured by resting-state fMRT and correlation analysis) at baseline compared to end of 3 day period of training

Measure: functional changes: Connectivity

Time: end of 3-day cognitive training vs baseline

---

Description: cortical excitability measured by transcranial magnetic stimulation (TMS)

Measure: cortical excitability

Time: at baseline

---

Description: quality of life as measured by standardized questionaire at baseline compared to quality of life measured 1 month after intervention (training and stimulation vs. training and sham-stimualtion)

Measure: Quality of Life

Time: after 1 month vs baseline

---

Description: memory performance tested at baseline compared to memory performance after the end of a 3-day cognitive training period and after 1 month (posttraining) in training and stimulation vs. training and sham stimulation

Measure: memory

Time: immediately after end of 3-day of cognitive training, after 1 month vs. baseline

---

Description: affective state measured at baseline compared to affective state measured after the end of a 3-day cognitve training period and after 1 month (posttraining) in training and stimulation vs. training and sham stimulation

Measure: affective state

Time: immediately after the end of 3-day cognitive training, after 1 month vs. baseline

---

Description: To assess predictors of positive reaction to brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF Val66Met, COMT Val158Met).

Measure: genotyping of learning related polymorphisms

Time: once

---

Primary Outcomes

Description: Investigation whether the combination of intensive visual-spatial training (LOCATO task) and tDCS leads to an improvement of visual-spatial learning and memory measured by performance in LOCATO task after end of a 3 day training period compared to sham stimulation.

Measure: Performance in LOCATO task (Visual-Spatial learning and memory) after a combination of intensive visual-spatial training and tDCS

Time: immediately after the end of a 3 day training period in tDCS condition compared to sham condition

---

Secondary Outcomes

Description: long term effects measured by performance in LOCATO task after end of training and after 1 month compared to control condition

Measure: long term effects

Time: after 1 month vs baseline

---

Description: Connectivity (measured by resting-state fMRT and correlation analysis) at baseline compared to end of 3 day period of training

Measure: functional changes: Connectivity

Time: after end of 3-day period of training vs baseline

---

Description: measured by transcranial magnetic stimulation (TMS) at baseline

Measure: cortical excitability

Time: at baseline

---

Description: quality of life as measured by standardized questionaire at baseline compared to quality of life measured 1 month after intervention (training and stimulation vs. training and sham-stimualtion)

Measure: Quality of life

Time: after 1 month vs baseline

---

Description: memory performance tested at baseline compared to memory performance after the end of a 3-day cognitive training period and after 1 month (posttraining) in training and stimulation vs. training and sham stimulation

Measure: memory

Time: immediately after end of 3-day of cognitive training, after 1 month vs. baseline

---

Description: affective state measured at baseline compared to affective state measured after the end of a 3-day cognitve training period and after 1 month (posttraining) in training and stimulation vs. training and sham stimulation

Measure: affective state

Time: immediately after the end of 3-day cognitive training, after 1 month vs. baseline

---

Description: To assess predictors of positive reaction to brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF Val66Met, COMT Val158Met).

Measure: genotyping of learning related polymorphisms

Time: once

---

Primary Outcomes

Description: Investigation whether the combination of intensive visual-spatial training (LOCATO task) and tDCS leads to improvement of visual-spatial learning and memory measured by the performance in LOCATO task after end of a 3 day period of training compared to sham stimulation.

Measure: performance in LOCATO task (visual-spatial learning and memory) after a combination of intensive visual-spatial training and tDCS

Time: immediately after end of a 3 day period of training in tDCS condition vs sham condition

---

Secondary Outcomes

Description: long term effetcs measured by performance in LOCATO task after end of training and after 1 month compared to control conditions

Measure: long term effects

Time: after 1 month vs baseline

---

Description: Connectivity (measured by resting-state fMRT and correlation analysis) at baseline compared to end of training

Measure: functional changes: Connectivity

Time: after end of 3-day cognitive training vs baseline

---

Description: cortical excitability measured by transcranial magnetic stimulation (TMS)

Measure: cortical excitability

Time: at baseline

---

Description: quality of life as measured by standardized questionaire at baseline compared to quality of life measured 1 month after intervention (training and stimulation vs. training and sham-stimualtion)

Measure: Quality of Life

Time: after 1 month vs baseline

---

Description: memory performance tested at baseline compared to memory performance after the end of a 3-day cognitive training period and after 1 month (posttraining) in training and stimulation vs. training and sham stimulation

Measure: memory

Time: immediately after end of 3-day of cognitive training, after 1 month vs. baseline

---

Description: To assess predictors of positive reaction to brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF Val66Met, COMT Val158Met).

Measure: genotyping of learning related polymorphisms

Time: once

---

Primary Outcomes

Measure: Frequency of the Bdnf gene Val/Val, Val/Met and Met/Met phenotypes as a function of relapse

Time: at the time of inclusion

---

Secondary Outcomes

Measure: serum BDNF levels variations between inclusion and 6 months later (or 4 months if the participants does not come for the 4 months-follow-up).

Time: 6 months after alcohol withdrawal

---

Measure: existence of a psychiatric co-morbidity at the inclusion (major depression, schizophrenia, anxiety disorder)

Time: at the time of inclusion

---

Measure: presence of a psychiatric co-morbidity at 6 months after withdrawal (major depression, schizophrenia, anxiety disorder)

Time: 6 month after alcohol withdrawal

---

Primary Outcomes

Description: The number of participants that attend and participate in the treatment at least 3 times per week for 8 weeks.

Measure: Frequency feasibility

Time: After completion of the 8 week trial

---

Description: The number of participants that complete at least 150 minutes per week of moderate intensity exercise (70%+ of their estimated HR maximum). This will be ascertained using heart rate monitors.

Measure: Aerobic feasibility

Time: At the end of the 8 week trial

---

Description: The number of participants that participate in strengthening exercises that incorporates all the major muscle groups at least two days per week.

Measure: Strength feasibility

Time: At the end of the 8 week trial

---

Description: Drop-out rate and reason for drop-out will be tracked.

Measure: Compliance

Time: At the end of the 8 week trial

---

Description: Exercise-related adverse events (e.g., strains/sprains, cardiovascular events).

Measure: Safety

Time: Ongoing throughout the 8 week trial

---

Description: The Intrinsic Motivation Inventory (IMI) will be used to gather information about motivation.

Measure: Motivation

Time: At 8 weeks

---

Description: Falls and fall injuries in and out of boot camp will be collected.

Measure: Falls

Time: At the end of the 8 week trial

---

Secondary Outcomes

Description: Falls will be tracked for 6 months after the boot camp using a falls diary. A member of the research team will call each month to interview participants about their falls. We will assess falls/fall injuries per physical activity ratio during the 6 month period following the trial and time to a fall/fall injury after the trial.

Measure: Falls

Time: up to 6 months

---

Description: Physical activity will be assessed using the Physical Activity Monitoring System (PAMsys).

Measure: Motor activity

Time: up to 6 months

---

Description: Fatigue will be assessed using the Parkinson Fatigue Scale (PFS).

Measure: Fatigue

Time: up to 6 months

---

Description: This will be assessed functionally using the 30 second Sit-To-Stand Test (30STS) for muscle strength.

Measure: Strength

Time: up to 6 months

---

Description: Cognition will be assessed using the Montreal Cognitive Assessment (MoCA).

Measure: Cognition

Time: up to 6 months

---

Description: This will be assessed by using a measure of disease-specific quality of life (Parkinson's Disease Questionnaire-39 (PDQ39)).

Measure: Quality of life

Time: up to 6 months

---

Description: All participants will track their participation in exercise and physical activity using an exercise diary for 6 months following the boot camp. Participants will be called monthly to reinforce completion of the exercise diary.

Measure: Long term behavioral change

Time: up to 6 months

---

Description: Performance-based balance tasks.

Measure: mini-Balance Evaluation Systems Test (mini-BESTest)

Time: up to 6 months

---

Description: Activities Specific Balance Confidence Scale (ABC)

Measure: Falls self-efficacy

Time: up to 6 months

---

Description: Self-report measurement tool: Falls Efficacy Scale (FES)

Measure: Fall Efficacy

Time: Up to 6 months

---

Description: Self-report of fall catastrophization: Catastrophization about Falls Questionnaire (CAFS)

Measure: Fall catastrophization

Time: Up to 6 months

---

Description: Self-report measure physical activity: International Physical Activity Questionnaire (IPAQ)

Measure: Physical activity

Time: Up to 6 months

---

Description: Unified Parkinson's Disease Rating Scale motor subscale (UDPRS III)

Measure: Motor symptoms

Time: Up to 6 months

---

Description: Self-report scale of avoidance behavior due to a fear of falling: Fear of Falls Avoidance Behavior Questionnaire (FFABQ)

Measure: Fear of falling

Time: Up to 6 months

---

Description: Endurance will be assessed using the 6 Minute Walk Test (6MWT).

Measure: Endurance

Time: Up to 6 months

---

Description: Bone health will be measured using bone mineral densiometry (BMD).

Measure: bone health

Time: up to 6 months

---

Description: Mood will be measured using the Beck Depression Inventory.

Measure: Mood

Time: up to 6 months

---

Description: Catalase concentrations from blood will be quantified utilizing enzyme-linked immunosorbent assays.

Measure: Catalase

Time: Up to 6 months

---

Description: Cytokine (TNFα, IL-6, IL-10) concentrations from blood will be quantified utilizing enzyme-linked immunosorbent assays.

Measure: Cytokines

Time: Up to 6 months

---

Other Outcomes

Description: Circulating BDNF concentrations from blood will be quantified utilizing enzyme-linked immunosorbent assays.

Measure: BDNF

Time: up to 6 months

---

Primary Outcomes

Description: Change Measurements of serum BDNF levels will be carried out by personnel blind to subjects' group assignment. Platelet and serum samples will be diluted with diluent included in the R&D Human BDNF Quantikine Enzym Linked Immunosorbent Assay (ELISA) kit (Yasuhito et al. 1987).

Measure: BDNF (change from baseline serum BDNF levels)

Time: Baseline, 1 month and 4 months

---

Secondary Outcomes

Description: Change from baseline in Positive and Negative Syndrome Scale (PANSS) scores at time 16 weeks

Measure: Symptoms (Change from baseline in Positive and Negative Syndrome Scale (PANSS) scores)

Time: Baseline and 4 months

---

Primary Outcomes

Description: Number of patients in each group who report 50% reduction in pain on the visual analogue scale 3 months after radiofrequency denervation for lumbar zygapophysial (facet) joint mediated pain

Measure: Responder Rate

Time: 3 months

---

Secondary Outcomes

Measure: Medication intake, Functional status, Ability to work and Quality of life

Time: 3 months

---

Other Outcomes

Description: To evaluate whether any specific and/or combination of SNPs observed could be related with the clinical outcomes measured in this study

Measure: Pre-specified Single Nucleotide Polymorphism (SNP) analysis

Time: 3 months

---

Primary Outcomes

Description: The MoCA will be used to assess general cognitive functions. It examines several cognitive domains with a total score of 30.

Measure: Change scores of Montreal Cognitive Assessment (MoCA)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The Stroop test will be used to assess the processing speed, inhibition, set-shifting, and selective attention abilities. The participants will be tested under 2 conditions: congruent and incongruent conditions. In the congruent condition, the color ink of a word is consistent with the written color name; while the color ink differs from the written color name under the incongruent condition.

Measure: Change scores of Stroop test

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The dual-task tests will be assessed to determine the ability for an individual to perform 2 tasks simultaneously. The investigators will assess the dual-task performance during walking and performing box and block test. The results of the dual-task tests will provide information regarding to whether the 2 tasks compete for the same class of neural resources or one of the tasks can be carried out automatically.

Measure: Change scores of Dual-task test

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The TUG test will be used to assess the mobility and dynamic balance ability. The participants will be required to stand up from a chair, walk 3 meters, turn around, then walk back to the chair, and sit down. The time to complete the TUG test has been shown to be a good indicator to detect potential fallers and frail elderly (Podsiadlo & Richardson, 1991). The test-retest reliability of TUG on individuals with cognitive impairment was excellent (Blankevoort, van Heuvelen, & Scherder, 2013).

Measure: Change scores of Timed up and go (TUG) test

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Secondary Outcomes

Description: Verbal fluency tests will be used to evaluate the semantic memory of the participants. The participants will be instructed to say as many words as possible from a given category (i.e., fruit or animal) in 1 minute. The validity, reliability, and normative performance of verbal fluency tests have been well-established (Harrison, Buxton, Husain, & Wise, 2000).

Measure: Change scores of the Verbal Fluency Test

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: Useful field of view (UFOV) is the visual area over which useful information could be obtained at a quick glance without eye or head movements. This UFOV will be assessed with the BrainHQ program. The UFOV will assess the abilities of visuomotor processing speed, divided attention, and selective attention (Ball, Edwards, & Ross, 2007).

Measure: Change scores of the Useful Field of View (UFOV)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The 30 second chair stand test (CST) will be assessed to indicate the strength and endurance level of the lower extremities. The participants will be asked to stand up from a standardized chair and then sit down as many times as possible within 30 seconds. The feasibility and reliability of using CST in people with cognitive impairment have been established to be good (Blankevoort et al., 2013).

Measure: Change scores of the 30 second chair stand test (CST)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The Chinese version of the International Physical Activity Questionnaires (IPAQ) is an international measure for health-related physical activity. A short form of IPAQ will be used to assess changes in physical activity before and after intervention in this study. The reliability and validity of IPAQ has been established across 12 countries (Craig et al., 2003).

Measure: Change scores of the Chinese version of the International Physical Activity Questionnaires (IPAQ)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: Assess activities of daily living

Measure: Change scores of the Barthel Index (BI)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: Assess activities of daily living.

Measure: Change scores of the Lawton Instrumental Activities of Daily Living Scale

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: Assess activities of daily living.

Measure: Change scores of the Disability Assessment for Dementia (DAD)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The Chinese version of QoLAD will be used.

Measure: Change scores of the Quality of Life in Alzheimer's Disease Instrument (QoLAD)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The Chinese version of CBI will be used.

Measure: Change scores of the Caregiver Burden Inventory (CBI)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The Chinese version of short form GDS will be used.

Measure: Change scores of the Geriatric Depression Scale (GDS)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The CIQ measures items relevant to home integration, social integration, and productive activities.

Measure: Change scores of the Community Integration Questionnaire (CIQ)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The actigraphy will be placed on the waist for a 3-day period immediately before and after the intervention. The participants will wear the actigraphy during all daily activities except for those that involve water (i.e., showering or swimming).

Measure: Change scores of the ActiGraph GX3 accelerometers Change scores of the ActiGraph

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The participant will be seated upright in a chair with back support, the knee will be placed in 90-degree flexion and the evaluator will stabilize the thing to eliminate synergistic movements. Participants will be asked to perform a maximal isometric contraction of knee flexion and extension with both lower extremities. The investigators will record the mean value of 3 attempts.

Measure: Change scores of evaluating isometric knee flexors and extensors muscle strength

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The participant is seated, with the elbow at 90-degree flexion. The investigators will record the mean value of 3 attempts.

Measure: Change scores of using hand dynamometer to measure grip strength of both hand

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The investigators will use the WMS-III subtests, including Faces Recognition (score range 0-48), Verbal Paired Associates (score range 0-32), Word Lists (0-48), and Spatial Span (0-32) to assess the immediate, delayed, and working memory tests. Higher scores indicated better performance for each subtest. The raw score of each subtest will also be transferred to standardized Z scores and summed to represent an index of general memory function.

Measure: Change scores of Wechsler Memory Scale - Third Edition (WMS-III)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The WAIS-III includes tests that evaluate cognitive functions in verbal comprehension, working memory, perceptual organization, and processing speed. The subtests that the investigators will use are the Digit Symbol-Coding (scores range 0-133) and Matrix Reasoning tests (0-26). The raw score of each subtest will also be transferred to standardized Z scores and summed to represent an index of general cognitive function.

Measure: Change scores of Wechsler Adult Intelligence Scale - Third Edition (WAIS-III)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: Saliva samples will be collected at baseline to determine the Brain-Derived Neurotrophic Factor (BDNF) val66met genotype.

Measure: BDNF val66met genotype

Time: baseline

---

Primary Outcomes

Measure: Change scores of Montreal Cognitive Assessment (MoCA)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Measure: Change scores of Wechsler Memory Scale - Third Edition (WMS-III)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Measure: Change scores of Wechsler Adult Intelligence Scale - Third Edition (WAIS-III)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Measure: Change scores of Useful Field of View (UFOV)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Measure: Change scores of Stroop Color-Word test

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The dual-task tests will be assessed to determine the ability for an individual to perform 2 tasks simultaneously. The investigators will assess the dual-task performance during walking and performing box and block test. The results of the dual-task tests will provide information regarding to whether the 2 tasks compete for the same class of neural resources or one of the tasks can be carried out automatically.

Measure: Change scores of Dual-task test

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Secondary Outcomes

Measure: Change scores of serum BDNF level

Time: Baseline, posttest (an expected average of 3 months)

---

Description: Antioxidative markers will be used to reflect the changes on oxidative stress. In particular, we will be analyzing the total antioxidant capacity (TAC).

Measure: Change scores of Antioxidative marker

Time: Baseline, posttest (an expected average of 3 months)

---

Description: HbA1C level will be tested to investigate the relationships between blood glucose level and aerobic exercise.

Measure: Change scores of Glucose indicator

Time: Baseline, posttest (an expected average of 3 months)

---

Description: The cholesterol ratio (total cholesterol divided by high-density lipid) will be evaluated to reflect the lipid level in the blood.

Measure: Change scores of Plasma lipid level

Time: Baseline, posttest (an expected average of 3 months)

---

Measure: Change scores of Functional Independence Measure (FIM)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Measure: Change scores of Lawton Instrumental Activities of Daily Living Scale (Lawton IADL)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Measure: Change scores of Stroke Impact Scale (SIS)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Measure: Change scores of Caregiver Burden (CB) scale

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Measure: Change scores of EuroQol (EQ)-5D questionnaire

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Measure: Change scores of Timed up and go test (TUG)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Measure: Change scores of Six-minute walk test (6MWT)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Measure: Change scores of Mobility level

Time: Baseline, posttest (an expected average of 3 months)

---

Measure: Change scores of International Physical Activity Questionnaires (IPAQ)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Measure: Change scores of Fugl-Meyer Assessment (FMA)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Measure: Change scores of Rivermead Mobility Index (RMI)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: We will evaluate isometric knee flexors and extensors muscle strength using handheld dynamometer. Also, we will use hand dynamometer to measure grip strength of the affected and less affected hand while the participant is seated, with the elbow at 90-degree flexion. We will record the mean value of 3 attempts.

Measure: Change scores of muscle strength

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Measure: Change scores of Community Integration Questionnaire (CIQ)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Measure: Change scores of Geriatric Depression Scale (GDS)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Measure: Genotyping of the BDNF val66met polymorphism

Time: Between baseline and posttest (an expected average of 3 months)

---

Primary Outcomes

Description: Beck Depression Inventory

Measure: Change in residual symptoms of depression. Self report.

Time: At baseline and immediately after ABM intervention (during first week after ABM).

---

Description: Hamilton Depression Rating Scale

Measure: Change in residual symptoms of depression. Clinician rating

Time: At baseline and immediately after ABM intervention (during first week after ABM).

---

Secondary Outcomes

Description: Measured by the MINI structured interview

Measure: Recurrence of major depressive episodes

Time: Will be measured 12 month after baseline

---

Description: Emotion Regulation Questionnaire (ERQ).

Measure: Changes in Emotion Regulation

Time: At baseline.

---

Description: The Rumination Response Scale

Measure: Changes in Rumination

Time: At baseline and 12 months after intervention

---

Description: Cortisol samples from saliva measured by diural variation (6 samples).

Measure: Changes in cortisol response.

Time: At baseline, immediately after ABM intervention and one month after intervention.

---

Description: Beck Anxiety Inventory

Measure: Changes in symptoms of anxiety

Time: At baseline, immediately after ABM intervention (during first week after ABM intervention), 1 month after intervention, 6 months after intervention and 12 months after intervention

---

Other Outcomes

Description: Automatic Thought Questionnaire (ATQ)

Measure: Automatic thoughts

Time: At baseline, immediately after ABM intervention (average one day), 1 month after intervention, 6 months after intervention and 12 months after intervention

---

Description: Perceived Stress Scale (PSS).

Measure: Changes in perceived stress

Time: At baseline, immediately after ABM intervention (average one day), , 1 month after intervention, 6 months after intervention and 12 months after intervention

---

Description: Positive and Negative Beliefs about Rumination scale (PBRS and NBRS)

Measure: Meta cognitions

Time: At baseline and 12 months after intervention

---

Measure: 5-HTTLPR+A>G polymorphic variation divided by the triallelic functional "high expressive" versus "low expressive" genotype will moderat the effect of ABM on residual symptoms compared to neutral ABM placebo condition

Time: Immediately after ABM intervention.

---

Measure: Brain Derived Neurotrophic Factor (BDNF) val66met polymorphic variation linked to Brian Derived Neurotrophic Factor (BDNF) variation will moderate the effect of ABM on residual symptoms compared to neutral ABM placebo condition

Time: Immediately after ABM intervention.

---

Measure: A serotonergic cumulative Genetic score, including (5-HHTLPR, HTR1A 8rs6295) and HTR 2A (rs 6311) polymorphisms will moderate the effects of ABM on residual symptoms compared to neutral placebo condition

Time: Immediately after ABM intervention.

---

Description: Beck Depression Inventory

Measure: Change in residual symptoms of depression. Self report

Time: One month after intervention, 6 months after intervention and 12 months after intervention

---

Description: Hamilton Depression Rating Scale

Measure: Change in residual symptoms of depression. Clinical rating

Time: One month after intervention, 6 month after intervention and 12 month after intervention

---

Measure: Primary outcome measures will be modified by the degree of attentional change during the ABM intervention.

Time: Immediately after the ABM intervention

---

Measure: Primary outcome measures will be modified by executive functioning

Time: At baseline

---

Primary Outcomes

Description: changes of skin conductane level(SCL) and skin conductance response(SCR)

Measure: Electrodermal activity(EDA)

Time: baseline, 0.5, 1,2,3 months

---

Description: changes of SDNN, RMSSD and LF/HF ratio

Measure: Heart rate variability

Time: baseline, 0.5, 1,2,3 months

---

Secondary Outcomes

Measure: Brain-derived neurotrophic factor(BDNF) genotyping: Val66Met

Time: baseline, 0.5, 1,2,3 months

---

Description: IL-1α, IL-1β, IL-2, IL-4, IL-6, IL-10, IL-12(p70), IFN-γ, TNF-α

Measure: Cytokines

Time: baseline, 0.5, 1,2,3 months

---

Measure: Leptin

Time: baseline, 0.5, 1,2,3 months

---

Measure: Adiponectin

Time: baseline, 0.5, 1,2,3 months

---

Measure: Epinephrine

Time: baseline, 0.5, 1,2,3 months

---

Measure: Norepinephrine

Time: baseline, 0.5, 1,2,3 months

---

Measure: C reactive protein

Time: baseline, 0.5, 1,2,3 months

---

Description: serum, plasma, platelet BDNF

Measure: BDNF

Time: baseline, 0.5, 1,2,3 months

---

Description: structured interview assessing for DSM-IV Axis I disorders with strong reliability and validity in relation to the Structured Clinical Interview for DSM-IV (SCID-IV)

Measure: MINI plus

Time: Baseline

---

Description: assess current and past Axis I diagnoses

Measure: MINI Suicidality Module

Time: baseline, 0.5, 1,2,3 months

---

Description: changes of HAMD-17 total socres

Measure: Hamilton Depression Rating Scale-17(HAMD-17)

Time: baseline, 0.5, 1,2,3 months

---

Description: changes of HAMA total scores

Measure: Hamilton Anxiety Rating Scale(HAMA)

Time: baseline, 0.5, 1,2,3 months

---

Description: ASI-3 to measure the three most supported AS domains: social (i.e., fear of exhibiting symptoms in public that may elicit embarrassment), cognitive (i.e., fear of losing cognitive control or experiencing concentration difficulties), and physical (i.e., fear that physical sensations are a sign of an immediate physical problem).

Measure: Anxiety Sensitivity Index(ASI)

Time: baseline, 0.5, 1,2,3 months

---

Description: The APPQ (Rapee et al., 1995) is a 27-item instrument that is designed to measure interoceptive, agoraphobic, and social situational fear. Subjects respond to each item on a 9-point Likert scale from 0 to 8, according to how much fear they think they would experience in a given situation so that total scores range from 0 to 216.

Measure: APPQ(Albany Panic and Phobia Questionnaire)

Time: baseline, 0.5, 1,2,3 months

---

Description: 16-item questionnaire that aims to measure the trait of worry, using Likert rating from 1 (not at all typical of me) to 5 (very typical of me)

Measure: PSWQ(Penn state worry questionnaire)

Time: baseline, 0.5, 1,2,3 months

---

Description: emotional, somatic, cognitive, and behavioral stress responses.

Measure: SRI(Stress response Inventory)

Time: baseline, 0.5, 1,2,3 months

---

Description: The Perceived Stress Scale (PSS) is the most widely used psychological instrument for measuring the perception of stress. It is a measure of the degree to which situations in one's life are appraised as stressful.

Measure: Perceived Stress Scale(PSS)

Time: baseline, 0.5, 1,2,3 months

---

Description: The Barratt Impulsiveness Scale (BIS) is a widely used measure of impulsiveness. It includes 30 items that are scored to yield six first-order factors (attention, motor, self-control, cognitive complexity, perseverance, and cognitive instability impulsiveness) and three second-order factors (attentional, motor, and non-planning impulsiveness).The BIS-11 is a 30-item self-report questionnaire, that is scored to yield a total score, three second-order factors, and six first-order factors.

Measure: Barratt Impulsivity Scale

Time: baseline, 0.5, 1,2,3 months

---

Description: The items assess panic frequency, distress during panic, panic-focused anticipatory anxiety, phobic avoidance of situations, phobic avoidance of physical sensations, impairment in work functioning, and impairment in social functioning. The overall assessment is made by a total score, which is calculated by summing the scores for all seven items. The total scores range from 0 to 28.

Measure: Panic disorder severity scale(PDSS)

Time: baseline, 0.5, 1,2,3 months

---

Primary Outcomes

Description: Stronger fMRI BOLD response in prefrontal cortical regions in ABMT compared to neutral AMB placebo condition.

Measure: BOLD response in prefrontal cortical regions

Time: Two weeks after after ABM-training

---

Secondary Outcomes

Description: Lower ABM fMRI BOLD response within the amygdala in ABMT compared to neutral ABM placebo condition.

Measure: BOLD response within the amygdala

Time: Two weeks after ABM-training

---

Description: Increased neural integrity as measured by fractional anisotropy values in the uncinate fasciculi (UF) in the active AMBT compared to neutral ABM placebo condition.

Measure: DTI

Time: Two weeks after ABM-training

---

Description: Increased integrity within the attentional networks at rest as measured by independent component analysis (ICA) in ABMT compared to neutral ABM training.

Measure: RSFC

Time: Two weeks after ABM-training

---

Description: The low expressive variant will be associated with more frontal BOLD activation and lower amygdala activation after ABMT

Measure: 5-HTTLPR + A>G polymorphic variation divided by the triallelic functional "high expressive" versus "low expressive" genotype will moderate the impact from ABMT as measured by whole brain BOLD responses.

Time: Two weeks after ABM-training

---

Description: Brain Derived Neurotropic Factor (BDNF) val66met polymorphic variation linked to Brain Derived Neurotropic Factor (BDNF) variation will differentiate between ABMT and neutral AMB placebo as measured by fMRI whole brain BOLD responses.

Measure: BDNF

Time: Two week after ABM-training

---

Description: A serotonergic cumulative Genetic score, including (5-HHTLPR, HTR1A 8rs6295) and HTR 2A (rs 6311) polymorphisms will moderate the effects of ABM on fMRI BOLD signal compared to a neutral placebo condition.

Measure: Serotonergic cumulative genetic score and fMRI

Time: Two weeks after ABM-training

---

Description: A serotonergic cumulative Genetic score, including (5-HHTLPR, HTR1A 8rs6295) and HTR 2A (rs 6311) polymorphisms will moderate the effects of ABM on structural MRI as measured by total grey matter volume compared to a neutral placebo condition.

Measure: Serotonergic cumulative genetic score and morphompetry

Time: Two weeks after ABM-training

---

Description: A serotonergic cumulative Genetic score, including (5-HHTLPR, HTR1A 8rs6295) and HTR 2A (rs 6311) polymorphisms will moderate the effects of ABM on DTI MRI as measured by fractional anisotropy compared to a neutral placebo condition.

Measure: Serotonergic cumulative genetic score and fMRI and DTI

Time: Two weeks after ABM-training

---

Primary Outcomes

Description: The MoCA will be used to assess general cognitive functions. It examines several cognitive domains with a total score of 30

Measure: Change scores of Montreal Cognitive Assessment (MoCA)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The WMS-III is a standardized and reliable neuropsychological examination tool designed to evaluate visuospatial and memory functions

Measure: Change scores of Wechsler Memory Scale - Third Edition (WMS-III)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The WAIS-III is developed to measure an individual's intelligence level. It includes tests that evaluate cognitive functions in verbal comprehension, working memory, perceptual organization, and processing speed

Measure: Change scores of Wechsler Adult Intelligence Scale - Third Edition (WAIS-III)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The UFOV assessment is a computer-based visual test containing three subtests: visuomotor processing speed, divided attention, and selective attention.

Measure: Change scores of Useful Field of View (UFOV)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The Stroop Color-Word assesses the abilities of selective attention, inhibition and executive function. The participants will be tested under congruent and incongruent conditions.

Measure: Change scores of Stroop Color-Word test

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The dual-task test evaluates the ability to shift attention between one task and another. Participants will perform the box and block test (BBT) while doing secondary cognitive tasks while sitting. Participants will perform BBT by affected and less affected hand.

Measure: Change scores of Dual-task test

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Secondary Outcomes

Description: Up-regulation of neurotrophic and vascular growth factors

Measure: Change scores of serum BDNF level

Time: Baseline, posttest (an expected average of 3 months)

---

Description: Antioxidative markers will be used to reflect the changes on oxidative stress. In particular, we will be analyzing the total antioxidant capacity (TAC).

Measure: Change scores of Antioxidative marker

Time: Baseline, posttest (an expected average of 3 months)

---

Description: HbA1C level will be tested to investigate the relationships between blood glucose level and aerobic exercise

Measure: Change scores of Glucose indicator

Time: Baseline, posttest (an expected average of 3 months)

---

Description: The cholesterol ratio (total cholesterol divided by high-density lipid) will be evaluated to reflect the lipid level in the blood.

Measure: Change scores of Plasma lipid level

Time: Baseline, posttest (an expected average of 3 months)

---

Description: The FIM assesses the dependence level of individuals with stroke to perform 18 activities (13 motor and five cognitive tasks) in daily living. The score ranges from 18 to 126 and higher scores demonstrate greater independent participation in daily activities.

Measure: Change scores of Functional Independence Measure (FIM)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The Lawton IADL scale assesses independent living skills, such as shopping or managing finances.

Measure: Change scores of Lawton Instrumental Activities of Daily Living Scale (Lawton IADL)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The SIS 3.0 will be used to evaluate health-related quality of life for patients with stroke. The SIS assesses eight domains (strength, hand function, ADL/IADL, mobility, communication, emotion, memory and thinking, and participation/role function) with 59 test items.

Measure: Change scores of Stroke Impact Scale (SIS)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: CB scale evaluates the burden of the primary caregiver of the participants. Lessening the burden of caregivers after the intervention may significantly improve the quality of life for patients with stroke and their family.

Measure: Change scores of Caregiver Burden (CB) scale

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The quality of life will be assessed by the EQ-5D questionnaire which comprises the following five dimensions: mobility, self-care, usual activities, pain/discomfort and anxiety/depression.

Measure: Change scores of EuroQol (EQ)-5D questionnaire

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The TUG assesses the dynamic balance ability and mobility. The participants will be required to stand up from a chair, walk 3 meters, turn around, walk back to the chair, and sit down.

Measure: Change scores of Timed up and go test (TUG)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The 6MWT measures the maximum distance walked over 6 minutes, which assess the endurance and mobility level of the participants. The participants could rest as needed during the course of the test.

Measure: Change scores of Six-minute walk test (6MWT)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: Accelerometers will be used to provide an objective measure of the amount of arm movements in real-life situations. The participants will be asked to wear an Actigraphy activity monitor.

Measure: Change scores of Mobility level

Time: Baseline, posttest (an expected average of 3 months)

---

Description: The IPAQ is an international measure of health-related physical activity.

Measure: Change scores of International Physical Activity Questionnaires (IPAQ)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The UE-FMA subscale will be used to assess the sensorimotor impairment level of UE in patients after stroke. The UE-FMA contains 33 movements with a score range from 0 to 66. A higher UE-FMA score indicates less impairment of the paretic limb. The validity and reliability of FMA is good to excellent.

Measure: Change scores of Fugl-Meyer Assessment (FMA)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The RMI evaluates the participant's bed mobility, postural transfers and walking ability. It contains a 15-item scale which includes 14 questions and one direct observation, with a total of score of 15.

Measure: Change scores of Rivermead Mobility Index (RMI)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: Accelerometers will be used to provide an objective measure of the amount of arm movements in real-life situations. The participants will be asked to wear an Actigraphy activity monitor. We will evaluate isometric knee flexors and extensors muscle strength using handheld dynamometer. Also, we will use hand dynamometer to measure grip strength of the affected and less affected hand while the participant is seated, with the elbow at 90-degree flexion. We will record the mean value of 3 attempts.

Measure: Change scores of muscle strength

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The CIQ measures items relevant to home integration, social integration, and productive activities.

Measure: Change scores of Community Integration Questionnaire (CIQ)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The Chinese version of short form GDS will be used.

Measure: Change scores of Geriatric Depression Scale (GDS)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: Up-regulation of neurotrophic and vascular growth factors

Measure: Genotyping of the BDNF val66met polymorphism

Time: Once during the intervention(an expected average of 3 months)

---

Description: In addition to MAL, the ActiGraph GX3 accelerometers (ActiGraph, Shalimar, FL, USA) will be used to quantitatively assess the amount of arm use in the participants' home settings.The actigraphy will be placed on bilateral wrist for 3 consecutive days before and after the 1-month intervention. The participants will carry the actigraphy all day except for activities that involve water, such as swimming or bathing. Using the actigraphy, investigators will be able to record and calculate the number of hand movements per minute, and the data will be analyzed with the MAHUFFE software (http://www.mrc-epid.cam.ac.uk/). The actigraphy has often been used to evaluate arm use in patients with stroke.

Measure: Change scores of Actigraphy

Time: Baseline, posttest (an expected average of 3 months)

---

Description: The Mini-Mental State Examination (MMSE) is the most commonly administered psychometric screening assessment of cognitive functioning. The MMSE is used to screen patients for cognitive impairment, track changes in cognitive functioning over time, and often to assess the effects of therapeutic agents on cognitive function. The total score of MMSE ranged from 0 to 30. Higher values represent a better cognitive functioning.

Measure: Change scores of Mini-Mental State Exam (MMSE)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The MRC is an ordinal scale that assesses muscle strength. The scoring for each muscle ranges from 0 to 5, with a higher score indicates stronger muscle. The reliability of MRC for all muscle groups was good to excellent in patients with stroke.

Measure: Change scores of Medical Research Council scale (MRC)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The National Institutes of Health Stroke Scale, or NIH Stroke Scale (NIHSS) is a tool used by healthcare providers to objectively quantify the impairment caused by a stroke. The NIHSS is composed of 11 items, each of which scores a specific ability between a 0 and 4. For each item, a score of 0 typically indicates normal function in that specific ability, while a higher score is indicative of some level of impairment. The individual scores from each item are summed in order to calculate a patient's total NIHSS score. The maximum possible score is 42, with the minimum score being a 0.

Measure: Change scores of National Institutes of Health Stroke Scale

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Primary Outcomes

Description: Measured by the parent-reported Pediatric Quality of Life Inventory school domain.

Measure: Change in child's health-related quality of life school functioning

Time: Baseline up to 12 months

---

Description: Measured by the Efficacy scale from the Parent Knowledge, Beliefs and Behaviors Questionnaire-3rd Revision (PBQ-R3).

Measure: Change in parental efficacy

Time: Baseline up to 12 months

---

Secondary Outcomes

Description: Measured by WIAT: reading and math scores and classroom grades from school report cards.

Measure: Objective academic performance (Child)

Time: Up to 12 months

---

Description: Measured by the Conners Parent Report Attention subscale.

Measure: Attention performance (Child)

Time: Up to 12 months

---

Description: Measured by PBQ-R3 Behaviors Scale.

Measure: Frequency of pro-learning behaviors (Parent)

Time: Up to 12 months

---

Description: Measured by the Parents' weekly time spent with child in pro-learning behaviors and activities.

Measure: Frequency of pro-learning behaviors (Parent)

Time: Up to 12 months

---

Description: Measured by PBQ-R3 Knowledge scale.

Measure: Knowledge of pro-learning parenting (Parent)

Time: Up to 12 months

---

Measure: Children's scores on other neurocognitive tests as assessed by learning, memory, and processing speed

Time: Up to 12 months

---

Measure: Parental reports of their children's HRQOL as measured by the PedsQL parent proxy questionnaire

Time: Up to 12 months

---

Primary Outcomes

Description: compare MEP amplitude in patients with that in healthy volunteers to identify whether depotentiation is weaker in focal dystonia

Measure: MEP amplitude immediately after the PAS25-cTBS150 (depotentiation) protocol

Time: throughout

---

Secondary Outcomes

Description: MEP amplitudes at other time points after the PAS25-cTBS150 procedure

Measure: MEP amplitudes

Time: throughout

---

Primary Outcomes

Description: The POMS questionnaire is an instrument to evaluate mood states. It has 65 items and 6 domains: tension-anxiety, depression, anger-hostility, vigour-activity, fatigue, and confusion- bewilderment. The total mood disturbance score is derived by subtracting the vigour-activity score from the the sum of scores from the other subscales. The iceberg profile is characterized by low raw scores on the tension, depression, anger, fatigue, and confusion scales and above norms (the "water line") on vigor.

Measure: Response of mood states after interventions

Time: Change from 5 minutes before the treatments to 5 and 20 minutes after three exercise intensities and quiet rest

---

Description: Anxiety Inventory-STAI trait-state. The scales encompasses 20 items and provides a one-dimensional measurement of anxiety. Range of scores for each subtest is 20-80, the higher score indicating greater anxiety. A cut point of 39-40 has been suggested to detect clinically significant symptoms.

Measure: Response of anxiety after interventions

Time: Change from 5 minutes before the treatments to 5 and 20 minutes after three exercise intensities and quiet rest

---

Secondary Outcomes

Description: The Physical Activity Readiness Questionnaire (PAR-Q) was originally designed as a screening questionnaire to be self-administered before beginning physical activity. It has been designed to identify the small number of adults for whom physical activity may be inappropriate or those who should have medical advice concerning the type of activity most suitable for them.The people who to answer yes to one or more of seven questions will be advised to consult their doctors before increasing their physical activity. Those who to answer no to all questions will be included in the protocol study.

Measure: Evaluation safety or possible risk of exercising

Time: baseline

---

Description: Habitual Physical Activity Level (BAECKE):The Baecke Questionnaire was developed to measure habitual physical activity. The questionnaire includes items about household activities, sport, and leisure time activities over the past year. The Sport Index is divided into four categories (<1 h; 1-2 hrs; 2-3 hrs; 3-4 hrs and > 4 hrs) and each of these categories has an appropriate coefficient (0.5; 1.5; 2.5; 3.5 and 4.5) Usual daily activity and leisure activity are scored in a range of from 0 to 5. Global PA will be the sum of 3 indexes.

Measure: Habitual Physical Activity Level

Time: Baseline

---

Description: Beck Inventory Anxiety and Depression: The Beck Depression and Anxiety Inventory consists of a self-report questionnaires. These instruments are used to measure the severity of depressive and anxiety episodes.These instruments are widely used by health professionals and researchers in a variety of clinical and research settings. In the Beck Depression Inventory normal score are between 0 and 15; medium depression scores from 15 to 20 (dysphoria), and high depression scores over 20, and in the Beck Anxiety Inventory: 0-9: normal to minimal anxiety;10-18: mild to moderate anxiety;19-29: moderate to severe anxiety and 30-63: severe anxiety.

Measure: Evaluation of depression and anxiety symptoms

Time: Baseline

---

Description: McArdle Step Test was developed to estimate the aerobic capacity of university students. For the test the individual must ascend and descend a step during 3 min with different stepping rates for women and men (22 and 24 steps/min, respective

Measure: Estimation the aerobic capacity

Time: Baseline

---

Description: The detection of the polymorphism in the SLC6A4 gene will be done by the PCR-RFLP method: restriction fragment length polymorphism (RFLP), in which the PCR amplification of the flanking region of the SNP is followed by the digestion reaction with a specific restriction enzyme. The polymorphism of the SLC6A4 gene will be determined by the Polymerase Chain Reaction (PCR) and subsequent gel electrophoresis. PCR will be performed with the following primers forward (GGCGTTGCCGCTCTGAATGC) and reverse (GAGGGACTGAGCTGGACAACCAC).

Measure: Detection of the polymorphism in the SLC6A4

Time: Baseline

---

Description: The BDNF Val66Met SNP rs6265 genotype (G196A) will be obtained, using a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method with forward (5'-ACTCTGGAGAGCGTGAAT-3') and reverse (5'-ATACTGTCACAC ACGCTC-3') primers, and further digestion of the PCR product with NlaIII enzyme (Cat. No. R0125S, New England Biolabs). From the five possible restriction fragments for this Val66Met amplicon, the genotype will be identified by the size and distribution of three bands: 243 bp for the G variant (Val), 168 bp and 75 bp bands for the A variant (Met), and these three bands for GA heterozygotes (Val/Met), on 2.5% (w/v) agarose gel electrophoresis.

Measure: Detection of the polymorphism BDNF Val66Met SNP rs6265 genotype (G196A)

Time: Baseline

---

Primary Outcomes

Description: pain scale; from 0 to 10; score 0: no pain, score 10: unbearable pain

Measure: Visual Analog Scale (VAS)

Time: change from baseline (1st menstrual phase, before tDCS) at one month (2nd menstrual phase, with tDCS), change from baseline (1st menstrual phase, before tDCS) at two months (3rd menstrual phase)

---

Description: Resting-state functional magnetic resonance imaging (rs-fMRI) is a well established method of functional magnetic resonance imaging (fMRI) that is used to evaluate regional interactions in the brain that occur in a resting (task-negative) state, when a subject is not performing an explicit task. Functional connectivity is the connectivity between brain regions that share functional properties, it can be defined as the correlation between spatially remote neurophysiological events, expressed as the neural networks of brain.

Measure: Functional connectivity of rs-fMRI Imaging

Time: change from baseline (before tDCS, before 2nd menstrual phase) at one week (after tDCS completion), change from baseline (before tDCS, before 2nd menstrual phase) at four weeks (before the 3rd menstrual phase)

---

Secondary Outcomes

Description: To assess the threshold of thermal sensation (cold, cold-pain, heat, heat-pain; from 0 to 50 centigrade temperature), according to the established protocol of an ascending limit approach for heat pain and a descending limit approach for cold pain.

Measure: Quantitative sensory testing (QST)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess anxious symptoms; from 20 to 80; score 20: not anxious, score 80: extremely anxious

Measure: Spielberger State-Trait Anxiety Inventory (STAI)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess anxious symptoms; from 0 to 63; score 0: not anxious, score 63: extremely anxious

Measure: Beck Anxiety Inventory (BAI)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess depressive symptoms; from 0 to 63; score 0: not depressed, score 63: extremely depressed

Measure: Beck Depression Inventory (BDI)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess pain-maladaptive psychological status; from 0 to 52; score 0: not pain Catastrophizing , score 52: extremely pain Catastrophizing

Measure: Pain Catastrophizing Scale (PCS)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess pain status; from 0 to 78; score 0: not painful, score 78: extremely painful

Measure: Long-form McGill Pain Questionnaire (MPQ)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess quality of life; he SF-36 consists of eight scaled scores, which are the weighted sums of the questions in their section. Each scale is directly transformed into a 0-100 scale on the assumption that each question carries equal weight. From 0 to 100; score 0: equivalent to maximum disability, score 100: no disability.

Measure: Short-Form Health Survey (SF-36)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess testosterone, progesterone, estrogen

Measure: Blood Hormones Measurement

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase)

---

Description: To genotype the single nucleotide polymorphism genotyping (i.e., BDNF Val66Met polymorphism (rs6265), COMT Val158Met polymorphism (rs4680), OPRM1 (rs1799971), 5HTR2A (rs6313), SLC6A4 (rs25531)) from blood specimen

Measure: Genotyping

Time: baseline

---

Description: To assure blinding efficacy; Patients do self-assessment about whether they receive real tDCS or sham tDCS. Assessment questionnaire:1 or 0. 1: real tDCS; 0: sham tDCS.

Measure: Efficacy of tDCS blinding

Time: At 1 months after tDCS intervention

---

Primary Outcomes

Description: pain scale; from 0 to 10; score 0: no pain, score 10: unbearable pain

Measure: Visual Analog Scale (VAS)

Time: change from baseline (1st menstrual phase, before tDCS) at one month (2nd menstrual phase, with tDCS), change from baseline (1st menstrual phase, before tDCS) at two months (3rd menstrual phase)

---

Description: Somatosensory evoked magnetic fields (SEFs) is a well established magnetoencephalographic (MEG) cortical response evoked by electric stimulation. SEFs to experimental pain stimulation using electrical stimulator applied on the skin over the trajectory of median nerve will be used to evaluate pain-evoked cortical response.

Measure: Somatosensory evoked magnetic fields to experimental pain

Time: change from baseline (before tDCS, before 2nd menstrual phase) at one week (after tDCS completion), change from baseline (before tDCS, before 2nd menstrual phase) at four weeks (before the 3rd menstrual phase)

---

Secondary Outcomes

Description: To assess the threshold of thermal sensation (cold, cold-pain, heat, heat-pain; from 0 to 50 centigrade temperature), according to the established protocol of an ascending limit approach for heat pain and a descending limit approach for cold pain.

Measure: Quantitative sensory testing (QST)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess anxious symptoms; from 20 to 80; score 20: not anxious, score 80: extremely anxious

Measure: Spielberger State-Trait Anxiety Inventory (STAI)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess anxious symptoms; from 0 to 63; score 0: not anxious, score 63: extremely anxious

Measure: Beck Anxiety Inventory (BAI)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess depressive symptoms; from 0 to 63; score 0: not depressed, score 63: extremely depressed

Measure: Beck Depression Inventory (BDI)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess pain-maladaptive psychological status; from 0 to 52; score 0: not pain Catastrophizing , score 52: extremely pain Catastrophizing

Measure: Pain Catastrophizing Scale (PCS)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess pain status; from 0 to 78; score 0: not painful, score 78: extremely painful

Measure: Long-form McGill Pain Questionnaire (MPQ)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess quality of life; he SF-36 consists of eight scaled scores, which are the weighted sums of the questions in their section. Each scale is directly transformed into a 0-100 scale on the assumption that each question carries equal weight. From 0 to 100; score 0: equivalent to maximum disability, score 100: no disability.

Measure: Short-Form Health Survey (SF-36)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

---

Description: To assess testosterone, progesterone, estrogen

Measure: Blood Hormones Measurement

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase)

---

Description: To genotype the single nucleotide polymorphism genotyping (i.e., BDNF Val66Met polymorphism (rs6265), COMT Val158Met polymorphism (rs4680), OPRM1 (rs1799971), 5HTR2A (rs6313), SLC6A4 (rs25531)) from blood specimen

Measure: Genotyping

Time: baseline

---

Description: To assure blinding efficacy; Patients do self-assessment about whether they receive real tDCS or sham tDCS. Assessment questionnaire:1 or 0. 1: real tDCS; 0: sham tDCS.

Measure: Efficacy of tDCS blinding

Time: At 1 months after tDCS intervention

---

Primary Outcomes

Description: Use of d' and response time as dependent variables. Based on signal detection theory, the discriminability index d' (d-prime) is calculated by using the formula d' = Z(hit rate) - Z(false alarm rate).

Measure: Change (post training - pre training) in working memory task performance (1-,2-,3-back).

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of working memory training.

---

Secondary Outcomes

Description: Trail Making Test (TMT) A and B. Results in seconds will be normalized by age and education adjusted standard values. Slower processing time indicates less cognitive flexibility and processing speed.

Measure: Change (post training - pre training) in cognitive flexibility and processing speed.

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training. And changes in follow-up sessions: 4 and 12 weeks after completion of working memory training.

---

Description: Trail Making Test (TMT) A and B. Results in seconds will be normalized by age and education adjusted standard values. Slower processing time indicates less cognitive flexibility and processing speed.

Measure: Change (follow-up - pre training) in cognitive flexibility and processing speed.

Time: Pre Training: 3-4 days before training start. Follow-up sessions: 4 and 12 weeks after completion of working memory training.

---

Description: Measure of different cognitive domains with the Brief Assessment of Cognition in Schizophrenia (BACS). Subscales (Verbal Memory, Working Memory, Motor Function, Verbal Fluency, Speed of Processing, Executive Function) and composite score. Taking age and gender into account, individual test scores are averaged to standardized scores (z-score) . Higher scores indicate better task performance.

Measure: Change (post training - pre training) in cognition.

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training. And changes in follow-up sessions: 4 and 12 weeks after completion of working memory training.

---

Description: Measure of different cognitive domains with the Brief Assessment of Cognition in Schizophrenia (BACS). Subscales (Verbal Memory, Working Memory, Motor Function, Verbal Fluency, Speed of Processing, Executive Function) and composite score. Taking age and gender into account, individual test scores are averaged to standardized scores (z-score) . Higher scores indicate better task performance.

Measure: Change (follow-up - pre training) in cognition.

Time: Pre Training: 3-4 days before training start. Follow-up sessions: 4 and 12 weeks after completion of working memory training.

---

Description: Use of the d' and response time as dependent variables. Based on signal detection theory, the discriminability index d' (d-prime) is calculated by using the formula d' = Z(hit rate) - Z(false alarm rate).

Measure: Change (follow-up - pre training) in working memory task performance (1-,2-,3-back).

Time: Pre Training: 3-4 days before training start. Follow up: 4 and 12 weeks after completion of working memory training.

---

Description: Calgary Depression Scale for Schizophrenia (CDSS). Maximum score is 27. Higher scores indicate a higher level of depression.

Measure: Change (post training - pre training) in depressive symptoms.

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training.

---

Description: Calgary Depression Scale for Schizophrenia (CDSS). Maximum score is 27. Higher scores indicate a higher level of depression.

Measure: Change (follow-up - pre training) in depressive symptoms.

Time: Pre Training: 3-4 days before training start. Follow-up sessions: 4 and 12 weeks after completion of working memory training.

---

Description: Positive and Negative Syndrome Scale (PANSS). The PANSS measures symptom severity on a positive, a negative and a general psychopathology scale. Higher scores indicate more pronounced symptom severity. The PANSS will be analyzed in subscales and as a summed total score.

Measure: Change (post training - pre training) in psychopathology.

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training. And changes in follow-up sessions: 4 and 12 weeks after completion of working memory training.

---

Description: Positive and Negative Syndrome Scale (PANSS). The PANSS measures symptom severity on a positive, a negative and a general psychopathology scale. Higher scores indicate more pronounced symptom severity. The PANSS will be analyzed in subscales and as a summed total score.

Measure: Change (follow-up - pre training) in psychopathology.

Time: Pre Training: 3-4 days before training start. Follow-up sessions: 4 and 12 weeks after completion of working memory training.

---

Description: Scale for the Assessment of Negative Symptoms (SANS). The total score is calculated by addition of 5 subscales with a maximum score of 25. A higher score indicates more pronounced negative symptoms.

Measure: Change (post training - pre training) in negative symptoms

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training.

---

Description: Scale for the Assessment of Negative Symptoms (SANS). The total score is calculated by addition of 5 subscales with a maximum score of 25. A higher score indicates more pronounced negative symptoms.

Measure: Change (follow-up - pre training) in negative symptoms

Time: Pre Training: 3-4 days before training start. And changes in follow-up sessions: 4 and 12 weeks after completion of working memory training.

---

Description: World Health Organization Quality of Life Questionnaire, short version (WHOQOL-BREF). Four major domains are assessed: physical, psychological, social relationships and environment. It consists of 26 items and a maximum score of 130. Higher scores indicate a higher quality of life.

Measure: Change (post training - pre training) in quality of life.

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training.

---

Description: World Health Organization Quality of Life Questionnaire, short version (WHOQOL-BREF). Four major domains are assessed: physical, psychological, social relationships and environment. It consists of 26 items and a maximum score of 130. Higher scores indicate a higher quality of life

Measure: Change (follow-up - pre training) in quality of life.

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training. And changes in follow-up sessions: 4 and 12 weeks after completion of working memory training.

---

Description: Subjective Scale to Investigate Cognition in Schizophrenia (SSTICS).Scale with 21 items, maximum score of 84, higher scores indicate more subjective cognitive impairment.

Measure: Change (post training - pre training) in subjective cognitive capacity.

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training.

---

Description: Subjective Scale to Investigate Cognition in Schizophrenia (SSTICS).Scale with 21 items, maximum score of 84, higher scores indicate more subjective cognitive impairment.

Measure: Change (follow-up - pre training) in subjective cognitive capacity.

Time: Pre Training: 3-4 days before training start. Follow-up sessions: 4 and 12 weeks after completion of working memory training.

---

Description: resting state connectivity, event-related potentials (ERP), 32-channel EEG

Measure: Differences in EEG signatures between interventional arms.

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training

---

Other Outcomes

Description: Examination of gene polymorphisms (BDNF Val66Met, COMT Val108Met158; CACNA1C) via polymerase chain reaction (PCR).

Measure: Influence of genetic constitution on tDCS effectiveness

Time: Pre Training: 3-4 days before training start

---

Description: Age in years; demographic questionnaire

Measure: Influence of age on tDCS effectiveness

Time: Pre Training: 3-4 days before training start

---

Description: Sex: male, female, not specified; self report questionnaire

Measure: Influence of sex on tDCS effectiveness

Time: Pre Training: 3-4 days before training start

---

Primary Outcomes

Description: We will evaluate the effect of sham vs active rTMS on negative symptom severity in the group with Cerebellar targeted rTMS and in the group with DLPFC targeted rTMS

Measure: Change in Negative Symptom Severity

Time: Before treatment (Baseline) and 1 week post treatment

---

Secondary Outcomes

Description: We will evaluate the effect of sham vs active rTMS on cerebellar-prefrontal cortex functional connectivity in the group with Cerebellar targeted rTMS and in the group with DLPFC targeted rTMS

Measure: Change in Cerebellar - Prefrontal Functional Connectivity

Time: Before treatment (Baseline) and 1 week post treatment

---

Description: We will evaluate the effect of sham vs active rTMS on the frequency and severity of auditory hallucinations in the group with Cerebellar targeted rTMS and in the group with DLPFC targeted rTMS

Measure: Change in Auditory Hallucination Severity

Time: Before treatment (Baseline) and 1 week post treatment

---

Primary Outcomes

Description: Corticospinal excitability as measured by single-pulse TMS-evoked responses in a hand and forearm muscles.

Measure: Corticospinal excitability

Time: 8 weeks

---

Description: Intracortical circuits as measured by paired-pulse TMS-evoked responses in a hand muscle

Measure: Intracortical circuits

Time: 8 weeks

---

Description: Spinal circuits as measured by spinal Hoffman reflexes from a forearm muscle

Measure: Spinal circuits

Time: 8 weeks

---

Description: Serum levels of BDNF as assessed by ELISA

Measure: Blood BDNF

Time: 8 weeks

---

Secondary Outcomes

Description: Serum levels of cathepsin B as assessed by ELISA

Measure: Cathepsin B

Time: 8 weeks

---

Description: Serum levels of IGF-1 as assessed by ELISA

Measure: IGF-1

Time: 8 weeks

---

Description: Serum levels of VEGF as assessed by ELISA

Measure: VEGF

Time: 8 weeks

---

Description: Serum levels of osteocalcin as assessed by ELISA

Measure: Osteocalcin

Time: 8 weeks

---

Description: Working memory as assessed by the Automated Operation Span (OSPAN) Task

Measure: Working memory

Time: 8 weeks

---

Description: Cardiorespiratory fitness as assessed by VO2 peak test

Measure: Cardiorespiratory fitness

Time: 8 weeks

---

Primary Outcomes

Description: Plasma BDNF protein levels, expressed in nanograms per milliliter, measured prior to any exercise upon completion of intervention.

Measure: BDNF level - Final

Time: Week 12

---

Secondary Outcomes

Description: Plasma BDNF protein levels, expressed in nanograms per milliliter, measured immediately following bout of aerobic exercise.

Measure: BDNF level - Post-exercise

Time: Week 6

---

Description: Genotyping of venous blood samples to determine ValVal, MetMet, and ValMet distribution.

Measure: BDNF Genotype

Time: Baseline

---

Description: Measured as VO2 max (ml/kg/min).

Measure: Cardiovascular Fitness - VO2 max

Time: Week 12

---

Description: Measured as estimated metabolic equivalents (kcal/kg/hour).

Measure: Cardiovascular Fitness - METs

Time: Week 12

---

Description: Total distance walked 6 minutes on a flat surface.

Measure: 6-minute Walk Test

Time: Week 12

---

Primary Outcomes

Description: Amplitude of motor evoked potential change (MEP)

Measure: Cortical excitabiliy changes induced by caffeine consumption

Time: Baseline (pre-measurement), immediately after intervention, 5 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 60 minutes

---

Secondary Outcomes

Description: Valine (Val) and Methionine (Met) alleles (i.e. Val66Met; Val66Val; Met66Met; Met66Val)

Measure: Brain-derived neurotrophic factor (BDNF) gene polymorphisms on cortical plasticity

Time: 3-6 months

---

Primary Outcomes

Description: Edinburgh Postnatal Depression Scale. Score range: 0-30. Higher scores indicate more symptoms of postpartum depression. Total group

Measure: Depressive symptoms

Time: Week 3-6 postpartum

---

Description: Score on the Hamilton 17-item depression scale. Score range: 0-52. Higher scores indicate more depressive symptoms. Assessed in imaging group

Measure: Depressive symptoms

Time: Week 3-6 postpartum

---

Description: 116 a priori defined gene transcripts, which where differentially expressed in third trimester of women who later developed perinatal depression with postpartum onset relative to pregnant women who did not and to other depressed (reference Mehta et al, 2014, Psychological Medicine) and confirmed to be coupled to estrogen fluctuations (Mehtaet al. 2018 British Journal of Psychiatry) will be evaluated in the total group. Also DNA methylation of the genes of these transcripts will be determined and analysed in terms of their predictive value (above chance) for perinatal depression.

Measure: Gene transcript and DNA methylation markers of estrogen sensitivity

Time: Prior to caesarean section

---

Description: Latent variable construct of brain 5-HT4R level based on quantification of 5-HT4R binding from 11C-SB207145 positron emission tomography in primary volumes of interest; neocortex, nucleus caudatus, putamen and hippocampus. Assessed in imaging group.

Measure: Cerebral serotonin 4 receptor binding postpartum

Time: Week 3-6 postpartum

---

Description: Assessed in total group

Measure: CSF levels of GABA

Time: On day of caesarean section

---

Description: Assessed in total group

Measure: CSF levels of serotonin metabolite (5-HIAA)

Time: On day of caesarean section

---

Description: Cortisol awakening response, area under the curve with respect to baseline from 0 to 60 minutes from awakening.

Measure: Cortisol awakening response

Time: Week 3-6 postpartum

---

Description: Provides an estimate of cortisol exposure up to 6 months prior to delivery, total group

Measure: Hair cortisol level mothers

Time: On day of caesarean section.

---

Description: Provides an estimate of fetal cortisol exposure, infants from total group

Measure: Hair cortisol level newborns

Time: Day 0-5 postpartum.

---

Description: Hippocampal brain volume (including hippocampus) from structural MRI, imaging group.

Measure: Hippocampal volumes

Time: Week 3-6 postpartum.

---

Description: fMRI (BOLD response) based assessment of brain activity in response to reward, relative to non-reward, stimuli. Assessed in imaging cohort

Measure: functional MRI response to reward

Time: Week 3-6 postpartum.

---

Description: rsfMRI based spontaneous co-fluctuations in low frequency BOLD signal, (functional connectivity). Assessed with rsfMRI scan in the resting state, i.e. non-goal oriented spontaneous thought and awake. Assessed in imaging group.

Measure: Resting state functional connectivity MRI

Time: Week 3-6 postpartum

---

Description: Change in epigenetic SERT status from late pregnancy to postpartum week 3-6.

Measure: Change in epigenetic SERT status

Time: From just before delivery to 3-6 weeks postpartum

---

Description: Composite measure of hsCRP, TNF-α, IL-6, IL-18 and IL-10 levels, total group

Measure: Concentration of inflammatory markers, i.e hsCRP and immunoactive cytokines, in peripheral blood

Time: At week 3-6

---

Description: fMRI (BOLD response) based assessment of brain activity to emotionally salient, relative to neutral, stimuli. Assessed in imaging cohort.

Measure: functional MRI response to emotional faces

Time: Week 3-6 postpartum.

---

Secondary Outcomes

Description: Score on the Hamilton 17-item depression scale. Score range: 0-52. Higher scores indicate more depressive symptoms. Assessed in imaging group

Measure: Depressive symptoms

Time: Day 3-5 postpartum

---

Description: Score on the Hamilton 17-item depression scale. Score range: 0-52. Higher scores indicate more depressive symptoms. Assessed in imaging group

Measure: Depressive symptoms

Time: Week 12 postpartum

---

Description: Edinburgh Postnatal Depression Scale. Score range: 0-30. Higher scores indicate more symptoms of postpartum depression. Assessed in total group

Measure: Depressive symptoms

Time: Day 3-5 postpartum

---

Description: Edinburgh Postnatal Depression Scale. Score range: 0-30. Higher scores indicate more symptoms of postpartum depression. Assessed in all

Measure: Depressive symptoms

Time: 6 months postpartum

---

Description: Assessed in total group

Measure: CSF levels of serotonin

Time: On day of caesarean section

---

Description: Assessed in total group

Measure: CSF levels of dopamine metabolites

Time: On day of caesarean section

---

Description: Assessed in total group

Measure: CSF levels of noradrenaline metabolites

Time: On day of caesarean section

---

Description: Composite measure of IFN-c, IFN-alfa TNF-alfa og IL-6, in total group

Measure: CSF levels of inflammatory markers

Time: On day of caesarean section

---

Description: Estradiol level in peripheral blood, total group

Measure: Estradiol level

Time: Prior to caesarean section.

---

Description: Estradiol level peripheral blood, total group

Measure: Estradiol level

Time: At week 3-6 postpartum.

---

Description: Estradiol change pre- to postpartum, peripheral blood total group

Measure: Change in estradiol level

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Progesterone level in peripheral blood

Measure: Progesterone level

Time: Prior to caesarean section.

---

Description: Progesterone level in peripheral blood

Measure: Progesterone level

Time: At week 3-6 postpartum.

---

Description: Progesterone change pre- to postpartum, peripheral blood total group

Measure: Change in progesterone level

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Allopregnanolone level in peripheral blood

Measure: Allopregnanolone level

Time: Prior to caesarean section.

---

Description: Allopregnanolone level in peripheral blood

Measure: Allopregnanolone level

Time: At week 3-6 postpartum.

---

Description: Change in allopregnanolone level in peripheral blood

Measure: Change in allopregnanolone level

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Cortisol change pre- to postpartum, peripheral blood total group

Measure: Change in cortisol level

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Cortisol awakening response, area under the curve with respect to baseline from 0 to 60 minutes from awakening.

Measure: Cortisol awakening response

Time: Week 12 postpartum

---

Description: Cortisol awakening response, area under the curve with respect to baseline from 0 to 60 minutes from awakening.

Measure: Cortisol awakening response

Time: Prior to caesarean section

---

Description: Change in cortisol awakening response, from caesarean section to 3-6 weeks postpartum.

Measure: Change in cortisol awakening response

Time: ´From baseline (caesarean section to week 3-6 postpartum)

---

Description: Methylation status for the SERT gene, total group

Measure: DNA methylation of the SERT gene

Time: Prior to caesarean section

---

Description: DNA Methylation status for the SERT gene, total group

Measure: DNA methylation of the SERT gene

Time: Week 3-6 postpartum

---

Description: Methylation status for the FK506-binding protein 51 (FKBP5) gene, total group

Measure: DNA methylation of the FK506-binding protein 51 (FKBP5) gene

Time: Prior to caesarean section.

---

Description: Methylation status for the FK506-binding protein 51 (FKBP5) gene, total group

Measure: DNA methylation of the FK506-binding protein 51 (FKBP5) gene

Time: Week 3-6 postpartum

---

Description: Change in methylation status for the FK506-binding protein 51 (FKBP5) gene from late pregnancy to postpartum week 3-6.

Measure: Change in DNA methylation of the FK506-binding protein 51 (FKBP5) gene

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Methylation status for the glucocorticoid receptor gene, total group

Measure: DNA methylation of the glucocorticoid receptor gene

Time: Prior to caesarean section.

---

Description: Methylation status for the glucocorticoid receptor gene, total group

Measure: DNA methylation of the glucocorticoid receptor gene

Time: Week 3-6 postpartum

---

Description: Change in methylation status for the glucocorticoid receptor gene from late pregnancy to postpartum week 3-6.

Measure: Change in DNA methylation of the glucocorticoid receptor gene

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Methylation status for the COMT gene, total group

Measure: DNA methylation of the COMT gene

Time: Prior to caesarean section.

---

Description: Methylation status for the COMT gene, total group

Measure: DNA methylation of the COMT gene

Time: Week 3-6 postpartum

---

Description: Change in methylation status for the COMT gene from just before delivery to 3-6 weeks postpartum

Measure: Change in DNA methylation of the COMT gene

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Methylation status for the MAO-A gene, total group

Measure: DNA methylation of the MAO-A gene

Time: Prior to caesarean section.

---

Description: Change in methylation status for the MAO-A gene, total group

Measure: Change in DNA methylation of the MAO-A gene

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Methylation status for the MAO-A gene, total group

Measure: DNA methylation of the MAO-A gene

Time: Week 3-6 postpartum

---

Description: Methylation status for the oxytocin receptor gene, total group

Measure: DNA methylation of the oxytocin receptor gene

Time: Prior to caesarean section.

---

Description: Methylation status for the oxytocin receptor gene, total group

Measure: DNA methylation of the oxytocin receptor gene

Time: Week 3-6 postpartum

---

Description: Change in methylation status for the oxytocin receptor gene, total group

Measure: Change in DNA methylation of the oxytocin receptor gene

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Methylation status for the oxytocin gene, total group

Measure: DNA methylation of the oxytocin gene

Time: Prior to caesarean section.

---

Description: Methylation status for the oxytocin gene, total group

Measure: DNA methylation of the oxytocin gene

Time: Week 3-6 postpartum

---

Description: Change methylation status for the oxytocin gene, total group

Measure: Change in DNA methylation of the oxytocin gene

Time: From baseline (caesarean section to week 3-6 postpartum)

---

Description: Composite measure of hsCRP, TNF-α, IL-6, IL-18 and IL-10 levels, total group

Measure: Systemic inflammation peripheral blood hsCRP and immunoactive cytokines

Time: Prior to caesarean section.

---

Description: Change in composite measure of hsCRP, TNF-α, IL-6, IL-18 and IL-10 levels, total group

Measure: Change in systemic inflammation peripheral blood hsCRP and immunoactive cytokines

Time: From baseline (caesarean section to week 3-6 postpartum

---

Description: Family History Assessment Module (OS-FHAM). Number of first degree relatives with a history of depressive episodes or bipolar disorder. Total group.

Measure: Self reported family history of mood disorders

Time: Day 3-5 postpartum or before

---

Description: Barratt Impulsiveness Scale (BIS-11), self-reported. Range: 30-120. Total group.

Measure: Self reported impulsiveness score

Time: Day 3-5 postpartum or before

---

Description: NEO-PI-R - Revised NEO Personality Inventory, self-reported. Participants may score 20-80 for each of the personality traits: openness, conscientiousness, extraversion, agreeableness, and neuroticism. The higher the score, the more prominent is the personality trait. Total group.

Measure: Self reported Neuroticism score from NEO personality questionnaire

Time: Day 3-5 postpartum or before

---

Description: Parental bonding instrument (PBI), both parents, self-reported. Total group.

Measure: Self reported parental bonding quality

Time: Day 3-5 postpartum or before

---

Description: Perceived Stress Scale (PSS), range 0-40, a score of 0 indicates no perceived stress. Total group.

Measure: Self-reported perceived stress

Time: Day 3-5 postpartum

---

Description: Perceived Stress Scale (PSS), range 0-40, a score of 0 indicates no perceived stress. Total group.

Measure: Self-reported perceived stress

Time: Week 3-6 postpartum

---

Description: Change in Perceived Stress Scale (PSS), range 0-40, a score of 0 indicates no perceived stress. Total group.

Measure: Change in self-reported perceived stress

Time: Change from day 3-5 to week 3-6 postpartum

---

Description: Snaith-Hamilton Pleasure Scale (SHAPS), range 0-14, a score of 0 indicates no self-reported anhedonia. Total group.

Measure: Self-reported anhedonia

Time: Day 3-5 postpartum

---

Description: Snaith-Hamilton Pleasure Scale (SHAPS), range 0-14, a score of 0 indicates no self-reported anhedonia. Total group.

Measure: Self-reported anhedonia

Time: Week 3-6 postpartum

---

Description: Change in Snaith-Hamilton Pleasure Scale (SHAPS) score, range 0-14, a score of 0 indicates no self-reported anhedonia. Total group.

Measure: Change in self-reported anhedonia

Time: Change from day 3-5 to week 3-6 postpartum

---

Description: Rumination Response Scale (RRS), range 22-88, a score of 22 indicates no ruminative symptoms. Total group.

Measure: Self-reported rumination

Time: Day 3-5 postpartum

---

Description: Rumination Response Scale (RRS), range 22-88, a score of 22 indicates no ruminative symptoms. Total group.

Measure: Self-reported rumination

Time: Week 3-6 postpartum

---

Description: Change in Rumination Response Scale (RRS) score, range 22-88, a score of 22 indicates no ruminative symptoms. Total group.

Measure: Change in elf-reported rumination

Time: Change from day 3-5 to week 3-6 postpartum

---

Description: Profile of Mood States (POMS), range 0-260, a score of 0 indicates no mood disturbance. Total group.

Measure: Self-reported mood

Time: Day 3-5 postpartum

---

Description: Profile of Mood States (POMS), range 0-260, a score of 0 indicates no mood disturbance. Total group.

Measure: Self-reported mood

Time: Week 3-6 postpartum

---

Description: Change in Profile of Mood States (POMS) score, range 0-260, a score of 0 indicates no mood disturbance. Total group.

Measure: Change in self-reported mood

Time: Change from day 3-5 to week 3-6 postpartum

---

Description: Pittsburgh Sleep Quality Index (PSQI), range 0-21, a score of 0 indicates a healthy sleep quality. Total group.

Measure: Self-reported sleep quality

Time: Day 3-5 postpartum

---

Description: Pittsburgh Sleep Quality Index (PSQI), range 0-21, a score of 0 indicates a healthy sleep quality. Total group.

Measure: Self-reported sleep quality

Time: Week 3-6 postpartum

---

Description: Change in Pittsburgh Sleep Quality Index (PSQI), range 0-21, a score of 0 indicates a healthy sleep quality. Total group.

Measure: Change in self-reported sleep quality

Time: Change from day 3-5 to week 3-6 postpartum

---

Description: Brief symptom Inventory-53 item (BSI-53), range 0-212, increasing score means worsening of symptoms.Total group.

Measure: Self-reported psychiatric symptoms

Time: Day 3-5 postpartum

---

Description: Brief symptom Inventory-53 item (BSI-53), range 0-212, increasing score means worsening of symptoms.Total group.

Measure: Self-reported psychiatric symptoms

Time: Week 3-6 postpartum

---

Description: Change in Brief symptom Inventory-53 item (BSI-53) score, range 0-212, increasing score means worsening of symptoms.Total group.

Measure: Change in self-reported psychiatric symptoms

Time: Change from day 3-5 to week 3-6 postpartum

---

Description: WHO-5 well-being index, range 0-100, low score means less well-being. Total group.

Measure: Self-reported well-being

Time: Day 3-5 postpartum

---

Description: WHO-5 well-being index, range 0-100, low score means less well-being. Total group.

Measure: Self-reported well-being

Time: Week 3-6 postpartum

---

Description: Change in WHO-5 well-being index, range 0-100, low score means less well-being. Total group.

Measure: Change in self-reported well-being

Time: Change from day 3-5 to week 3-6 postpartum

---

Description: State Trait Anxiety Inventory (STAI-AD-D), state and trait subscales each have a range of 20-80, 20 means no anxiety. Total group.

Measure: Self-reported anxiety

Time: Day 3-5 postpartum

---

Description: State Trait Anxiety Inventory (STAI-AD-D), state subscale range 20-80, 20 means no anxiety. Total group.

Measure: Self-reported anxiety

Time: Week 3-6 postpartum

---

Description: Change in State Trait Anxiety Inventory (STAI-AD-D) score, state subscale range 20-80, 20 means no anxiety. Total group.

Measure: Change in self-reported anxiety

Time: Change from day 3-5 to week 3-6 postpartum

---

Description: Obsessive-Compulsive Inventory (OCI) score, self-reported, range 0-72, higher scores indicate more symptoms. Total group.

Measure: Self-reported obsessive and compulsive symptoms

Time: Day 3-5

---

Description: Obsessive-Compulsive Inventory (OCI) score, self-reported, range 0-72, higher scores indicate more symptoms. Total group.

Measure: Self-reported obsessive and compulsive symptoms

Time: Week 3-6 postpartum

---

Description: Change in Obsessive-Compulsive Inventory (OCI) score, self-reported, range 0-72, higher scores indicate more symptoms. Total group.

Measure: Change in self-reported obsessive and compulsive symptoms

Time: Change from day 3-5 to week 3-6 postpartum

---

Description: Performance on Simple Reaction Time, in imaging cohort.

Measure: Performance on Simple Reaction Time

Time: Week 3-6 postpartum

---

Description: Gray matter brain volume prefrontal cortex and anterior cingulate cortex

Measure: Gray matter brain volume prefrontal cortex and anterior cingulate cortex

Time: At week 3-6 postpartum

---

Description: Composite measure of serotonin, tryptophan og tryptofan hydroxylase levels relative to 5-HIAA, in placenta sample. Infants from total group

Measure: Serotonergic turnover in placenta

Time: At delivery.

---

Description: 11-beta-hydroxysteroid dehydrogenase type 2 activity in placenta. Infants from total group

Measure: 11-beta-hydroxysteroid dehydrogenase type 2 activity in placenta

Time: At delivery

---

Description: Composite measure of methylation status for the FKBP5, glucocorticoid receptor, 11-beta hydroxysteroid dehydrogenase type 2 genes. Infants from total group

Measure: Methylation status of genes relevant for stress-hormone regulation in placenta

Time: At delivery

---

Description: Composite measure of the methylation status for monoamine oxidase, serotonin receptor and serotonin transporter genes. Infants from total group

Measure: Methylation status of genes related to serotonergic signaling in placenta

Time: At delivery

---

Description: Composite measure of methylation status and gene transcript profiles of Glucocorticoid receptor, FKBP5, oxytocin and oxytocin receptors, Brain-derived neurotrophic factor (BDNF) genes. Assessed in blood from umbilical cord blood sample from infants, total group.

Measure: Methylation status and gene transcript profiles of relevance for early brain development and stress regulation in newborn infants

Time: At delivery.

---

Other Outcomes

Description: val158met (rs4680) status, binary variable, i.e. "val/val, val/met" vs "met/met" variants

Measure: COMT-genotype (rs4680) variant, i.e met/met vs other polymorphisms

Time: Prior to caesarean section.

---

Description: BDNF val66met (rs6265) status, binary variable, i.e. "val/val" versus "met-carrier" status

Measure: BDNF genotype (rs6265) status, i.e. val/val versus met-carrier variants

Time: Prior to caesarean section.

---

Description: 5-HTTLPR genotype status (binary), i.e. high-expressing LALA vs low-expressing (S or LG) variants, based on SLC6A4, i.e. L or S variants, and further subtyping on rs25531 haplotype L(A)L(A) vs LGLA, LGLG or variants containing as S as specified above.

Measure: 5-HTT genotype status, i.e LALA vs low-expressing (S or LG) variants

Time: Prior to caesarean section.

---

Description: In house interview based on Kennerley Maternity Blues Questionnaire, range: 0-28, higher score indicates more severe postpartum blues symptoms. High blues score is associated with greater risk for perinatal depression at week 3-6.

Measure: Postpartum blues symptoms

Time: Day 3-5 postpartum.

---

Description: In house interview based on Stein's Maternity Blues Scale, range 0-26. High blues score is associated with greater risk for perinatal depression at week 3-6.

Measure: Postpartum blues symptoms

Time: Day 3-5 postpartum.

---

Primary Outcomes

Description: An index of the duration of the Theta-Burst Stimulation (TBS) induced modulation of corticospinal excitability (the time-point at which the normalized mean Motor Evoked Potential (MEP) amplitude returns to baseline values) will be defined for each participant.

Measure: Change in TMS Plasticity Measures

Time: baseline and after 8 weeks of exercise

---

Description: Cognitive performance will be assessed using a neuropsychological test battery in executive function, processing speed, learning, and language.

Measure: Change in Cognitive Performance

Time: baseline and after 8 weeks of exercise

---

Secondary Outcomes

Description: Blood samples will be collected for BDNF levels.

Measure: Changes in BDNF Levels

Time: baseline and after 8 weeks of exercise

---

Description: A maximal treadmill test will be performed to determine maximal oxygen uptake (VO2) as a measure of aerobic capacity.

Measure: Change in Aerobic Capacity (Cardiovascular Fitness)

Time: baseline and after 8 weeks of exercise

---

Description: Genetic testing will be performed to assess for brain-derived neurotrophic factor (BDNF) Val66Met polymorphism.

Measure: Allelic Status BDNF

Time: baseline

---

Description: Genetic testing will be performed to assess for the presence of apolipoprotein-E (APOE) e4 allele.

Measure: Allelic Status APOE

Time: baseline

---

Primary Outcomes

Description: Assessment of atopic dermatitis severity is conducted using Scoring of Atopic Dermatitis (SCORAD) index. SCORAD index formula is: A/5 + 7B/2 + C. In this formula A is defined as the extent (0-100), B is defined as the intensity (0-18) and C is defined as the subjective symptoms (0-20). The maximum SCORAD score is 103. SCORAD <23 - mild AD; SCORAD from 23 to 63 - moderate AD; SCORAD> 63 - severe AD.

Measure: Assessment of change in the severity of atopic dermatitis after conventional treatment from study onset (baseline) at week 10

Time: At disease onset (study baseline) and at week 10

---

Description: Assessment of the psoriasis severity is conducted using Psoriasis Area and Severity Index (PASI). The patient's body is divided into four sections (head (H) (10% of a person's skin); arms (A) (20%); trunk (T) (30%); legs (L) (40%)). The percent of skin lesions of each area is assessed as follows: 0 (0% of involved area); 1 (< 10%); 2 (10-29%); 3 (30-49%); 4 (50-69%); 5 (70-89%); 6 (90-100%). Further, for each region, the intensity of 3 clinical signs is evaluated - redness, thickness and scaling and assessed as follows: 0 - no lesions,1 - easy, 2 - moderate, 3 - severe, 4 - very severe. The sum of all three severity parameters is calculated for each section, multiplied by the area score for that area and multiplied by weight of respective section (0.1 for head, 0.2 for arms, 0.3 for body, 0.4 for legs). PASI range is from 0 (no disease) to 72 (maximum disease). The severity of psoriasis is assessed as follows: PASI <20 - mild; PASI from 20 to 50 - moderate; PASI> 50 - severe

Measure: Assessment of change in the severity of psoriasis after conventional treatment from study onset (baseline) at week 10

Time: At disease onset (study baseline) and at week 10

---

Description: Depression is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Depression Rating Scale (HAM-D) using the following ranges: absence, ≤7; mild, 8-16; moderate, 17-27; severe, ≤28

Measure: Assessment of change in the severity of depression in atopic dermatitis and psoriasis patients after conventional treatment from study onset (baseline) at week 10

Time: At disease onset (study baseline) and week 10

---

Description: Depression is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Depression Rating Scale (HAM-D) using the following ranges: absence, ≤7; mild, 8-16; moderate, 17-27; severe, ≤28

Measure: Assessment of the severity of depression in healthy controls (HC)

Time: At disease onset (study baseline)

---

Description: Anxiety is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Anxiety Rating Scale (HAM-A) using the following ranges: ≤17, easy; 18-24, moderate; over 25, medium-severe

Measure: Assessment of change in the severity of anxiety in atopic dermatitis and psoriasis patients after conventional treatment from study onset (baseline) at week 10

Time: At disease onset (study baseline) and week 10

---

Description: Anxiety is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Anxiety Rating Scale (HAM-A) using the following ranges: ≤17, easy; 18-24, moderate; over 25, medium-severe

Measure: Assessment of the severity of anxiety in HC

Time: At disease onset (study baseline)

---

Description: The total IgE levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 0.000-100.0 IU/ml

Measure: Evaluation of changes in serum immunoglobulin E (IgE, IU/ml) levels from study onset (baseline) at week 10 in atopic dermatitis patients

Time: At disease onset (study baseline) and week 10

---

Description: The total IgE levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 0.000-100.0 IU/ml

Measure: Analysis of serum IgE (IU/ml) levels in HC

Time: At disease onset (study baseline)

---

Description: Serum BDNF levels are analyzed using a solid-phase, sandwich, two-site, ELISA (Promega, US; G7610). No measurement scale is used

Measure: Evaluation of changes in serum Brain Derived Neurotrophic Factor (BDNF, ng/ml) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients

Time: At disease onset (study baseline) and week 10

---

Description: Serum BDNF levels are analyzed using a solid-phase, sandwich, two-site, ELISA (Promega, US; G7610). No measurement scale is used

Measure: Analysis of serum BDNF (ng/ml) levels in HC

Time: At disease onset (study baseline)

---

Description: The total cortisol levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 138-690 nmol/L

Measure: Evaluation of changes in cortisol (nmol/L) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients

Time: At disease onset (study baseline) and week 10

---

Description: The total cortisol levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 138-690 nmol/L

Measure: Analysis of serum cortisol (nmol/L) levels in HC

Time: At disease onset (study baseline)

---

Description: The total testosterone levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: men 20-49 years - 72 -853ng/dL; men≥50 years -129-767 ng/dL; women ovulating - 0.010-73.0 ng/dL; women postmenopausal - 0.010-43.0 ng/dL.

Measure: Evaluation of changes in testosterone (ng/dL) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients

Time: At disease onset (study baseline) and week 10

---

Description: The total testosterone levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: men 20-49 years - 72 -853ng/dL; men≥50 years -129-767 ng/dL; women ovulating - 0.010-73.0 ng/dL; women postmenopausal - 0.010-43.0 ng/dL.

Measure: Analysis of serum testosterone (ng/dL) levels in HC

Time: At disease onset (study baseline)

---

Description: DNA extraction and genotyping the BDNF rs6265 (Val66Met) gene polymorphism in AD, PS and HC

Measure: DNA extraction in AD, PS and HC

Time: At disease onset (study baseline)

---

Secondary Outcomes

Description: EAD and IAD patients will be divided into subgroups in accordance with BDNF gene polymorphism and gender with following assessment of SCORAD scores compared with baseline after conventional treatment at week 10 in each group using unpaired t-test

Measure: Assessment and comparison (Unpaired t-test) of SCORAD scores in extrinsic atopic dermatitis (EAD, IgE level above the normal) and intrinsic atopic dermatitis (IAD, normal IgE level) patients compared with baseline after conventional treatment at week 10

Time: At disease onset (study baseline) and week 10

---

Description: Psoriasis patients will be divided into subgroups in accordance with BDNF gene polymorphism and gender with following assessment of PASI scores compared with baseline after conventional treatment at week 10 in each group.

Measure: Assessment and comparison (Unpaired t-test) of PASI scores in psoriasis patients compared with baseline after conventional treatment at week 10 in accordance with BDNF gene polymorphism (Val/Val; Val/Met;Met/Met) and gender(males, females)

Time: At disease onset (study baseline) and week 10

---

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of HAM-D scores in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of HAM-D scores in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of HAM-D scores in EAD, IAD, PS and HC

Time: At disease onset (study baseline) and week 10

---

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of HAM-A scores in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of HAM-A scores in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of HAM-A scores in EAD, IAD,PS and HC

Time: At disease onset (study baseline) and week 10

---

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of serum BDNF(ng/ml) levels in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of serum BDNF levels in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of serum BDNF (ng/ml) levels in EAD, IAD,PS and HC

Time: At disease onset (study baseline) and at week 10

---

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for comparisons of serum cortisol (nmol/L) levels in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of serum cortisol levels in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of serum cortisol (nmol/L) levels in EAD, IAD,PS and HC

Time: At disease onset (study baseline) and at week 10

---

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of serum testosterone (ng/dL) levels in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of serum testosterone levels in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of serum testosterone (ng/dL) levels in EAD, IAD,PS and HC

Time: At disease onset (study baseline) and at week 10

---

Description: Assessment of testosterone/cortisol ratio in EAD, IAD, PS patients and HC divided into BDNF rs6265 gene polymorphism (Val/Val; Val/Met; Met/Met) and gender (males, females) at study baseline and week 10

Measure: Assessment of testosterone/cortisol ratio in EAD, IAD, PS patients and HC in accordance with BDNF rs6265 gene polymorphism and gender

Time: At disease onset (study baseline) and at week 10

---

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of testosterone/cortisol ratio in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of testosterone/cortisol ratio in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of testosterone/cortisol ratio in EAD, IAD, PS and HC

Time: At disease onset (study baseline) and at week 10

---

Description: Correlation analysis of dermatological, psychological and biochemical parameters in EAD, IAD and PS patients, and HC divided into groups in accordance with BDNF rs6265 gene polymorphism (Val/Val; Val/Met; Met/Met) and gender (males, femaes)

Measure: Correlation analysis of studied parameters in dermatological patients and HC

Time: At disease onset (study baseline) and week 10

---

Primary Outcomes

Description: any adverse events that might be related to study procedures

Measure: Adverse Events

Time: enrollment to 3 month followup

---

Description: Upper extremity motor impairment scale. Scale ranges from 0 (worst, can not perform any tasks) to 66 ( performs all tasks fully).

Measure: Upper Extremity Fugl-Meyer Score

Time: change between before and 3 months follow-up

---

Secondary Outcomes

Description: Timed performance of 15 functional upper extremity tasks, 0-120 seconds, and 2 strength measures. WMFT time measurements are calculated as the arithmetic mean of rate of performance, where we calculate "how many times would a person have completed the task, had he or she been performing it continuously for 60 seconds". Therefore the results have a minimum score of 0, where the subject could not perform any of the tasks, and no pre-defined maximum score, the higher the rate score the faster the subject was able to perform the tasks. ( see Hodics et al.,2013)

Measure: Wolf Motor Function Test

Time: change between before and at 3 months follow-up

---

Primary Outcomes

Description: centralized ELISA assay with Simoa - Quanterix kit technology at the Laboratory of Clinical Proteomic Biochemistry of Montpellier, France.

Measure: BDNF(csf) in HD subjects compared to age-matched control subjects (+/- 5 years)

Time: Inclusion

---

Secondary Outcomes

Measure: plasmatic BDNF in HD subjects vs controls

Time: Inclusion

---

Measure: Correlation between BDNF in CSF and BDNF in plasma

Time: Inclusion

---

Description: Correlation between BDNF in CSF or plasma and: disease severity, assessed through the Huntington Disease Rating Scale (UHDRS), the disease burden formula [(n.CAG-35.5) x age], the Total Functional Capacity functional scale (TFC), and cognitive scales (Symbol Digit Modalities Test, STROOP test, Trail Making test A and B, direct and indirect digit span); - MRI brain imaging: cerebral and striatal atrophy by morphological imaging, functional resting state MRI, and anatomical connectivity by diffusion tensor imaging

Measure: Correlation between BDNF and disease parameters

Time: Inclusion

---

Measure: Total Tau and NFL levels in plasma and CSF in HD subjects vs control subjects

Time: Inclusion

---

Measure: TrkBcsf level in subjects with HD vs control subjects

Time: Inclusion

---

Primary Outcomes

Description: The Mini-Mental State Exam (MMSE) is used to screen patients for cognitive impairment, track changes in cognitive functioning over time, and often to assess the effects of therapeutic agents on cognitive function. Its range of total score is 0-30 with higher values indicating better cognitive function.

Measure: Change scores of Mini-Mental State Exam (MMSE)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The Montreal Cognitive Assessment (MoCA) will be used to assess general cognitive functions. It examines several cognitive domains with a total score of 30 and higher values indicate better cognitive functions. The MoCA has been shown to be a valid and promising tool to evaluate the global cognitive function in patients with stroke. The psychometric properties of MoCA are good to excellent for patients with cerebrovascular diseases.

Measure: Change scores of the Montreal Cognitive Assessment (MoCA).

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: Several subtests of Wechsler Memory Scale - Third Edition (WMS-III) including Faces Recognition (total scale=48), Verbal Paired Associates (total scale = 32), Word Lists (total scale = 48), and Spatial Span (total scale=32) will be used to assess the immediate, delayed, and working memory tests. For each subtest, a higher number indicates better performance in memory function. The raw score of subtests will also be transferred to standardized Z scores and summed to represent an index of general memory function.

Measure: Change scores of Wechsler Memory Scale - Third Edition (WMS-III)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The Wechsler Adult Intelligence Scale - Third Edition (WAIS-III) is developed to measure an individual's intelligence level. The Digit Symbol-Coding (score range 0-133) and Matrix Reasoning (range 0-26) subtests will be used.A higher score indicating better performance. The raw score of each subtest will also be transferred to standardized Z scores and summed to represent an index of general cognitive function.

Measure: Change scores of Wechsler Adult Intelligence Scale - Third Edition (WAIS-III)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The UFOV is a computer-based visual test containing three subtests: visuomotor processing speed, divided attention, and selective attention (Ball, Edwards, & Ross, 2007). The UFOV has been shown to have good test-retest reliability and validity to assess patients with stroke (George & Crotty, 2010).

Measure: Change scores of Useful Field of View (UFOV)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The Stroop Color-Word test assesses the abilities of selective attention, inhibition and executive function. The participants will be tested under congruent and incongruent conditions. In the congruent condition, the participant will name the color ink of a word which is consistent with the written color name; whereas in the incongruent condition the participant will name the color ink differs from the written color name. In both conditions, the number of colors correctly named within 45 seconds will be measured and the performance in the congruent condition will be compared with the incongruent condition (Quaney et al., 2009).

Measure: Change scores of Stroop Color-Word Test

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The Dual-Task test evaluates the ability of set-shifting. Participants will sit and perform the box and block test (BBT) or walk 10 meters while doing secondary cognitive or motor tasks. Two cognitive secondary tasks will be performed by the participants: (1) arithmetic task: participants will be asked to perform serial subtractions by 7 starting from 100 or random two-digit numbers (e.g., Baetens et al., 2013); (2) tone discrimination task: participants will be presented a number of low and high-pitched tones and they will respond to either the high or low-pitched tones during the trial. Both cognitive task performances will be recorded and the results will be compared to single cognitive task performance. In addition to the cognitive dual-task, participants will perform a motor task (e.g., holding a cup of water) while walking.

Measure: Change scores of Dual-Task test

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The TUG assesses the dynamic balance ability and mobility. The participants will be required to stand up from a chair, walk 3 meters, turn around, walk back to the chair, and sit down. The test-retest reliability of TUG on individuals with stroke was excellent (Ng & Hui-Chan, 2005).

Measure: Change scores of Timed Up and Go Test (TUG)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The 6MWT measures the maximum distance walked over 6 minutes, which assess the endurance and mobility level of the participants. The participants could rest as needed during the course of the test. The test-retest reliability and responsiveness has been established to be high for patients with chronic stroke (Fulk, Echternach, Nof, & O'Sullivan, 2008).

Measure: Change scores of Six-Minute Walk Test (6MWT)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: Accelerometers will be used to provide an objective measure of the amount of arm movements in real-life situations. The participants will be asked to wear an Actigraphy activity monitor (ActiGraph, Shalimar, FL, USA) on both wrists for 3 consecutive days before and after training to measure the number of moves each minute, and the average counts of move per minute. The participants will be required to wear the device during the day except for doing water-based activities, such as bathing or swimming.The use of actigraphy to measure arm use and physical activity has been established for patients with stroke (Freedson, Melanson, & Sirard, 1998; Maguire et al., 2012).

Measure: Change scores of Mobility Level

Time: Baseline, posttest (an expected average of 3 months)

---

Description: The short form version of International Physical Activity Questionnaires (IPAQ) assesses sitting, walking, moderate-intensity activities and vigorous intensity activities. Frequency (measured in days per week) and duration (time per day) are collected separately and transferred to MET-minutes values for each specific type of activity. A combined total physical activity MET-min/week can be computed as the sum of Walking + Moderate + Vigorous MET-min/week scores. Higher total scores indicated more health-related activities.

Measure: Change scores of International Physical Activity Questionnaires (IPAQ)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The upper limb subscale of the Fugl-Myer Assessment (FMA-UE) assesses the motor impairments of upper limbs after stroke. The FMA-UE contains 33 movements with a score range from 0 to 66. A higher score indicated better motor recovery in upper limbs.

Measure: Change scores of Fugl-Myer Assessment (FMA)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The Rivermead Mobility Index (RMI) evaluates the participant's functional mobility, balance, gait and walking ability. It contains a 15-item scale which includes 14 questions and one direct observation, with a total of score of 15 and higher scores indicating better mobility performance.

Measure: Change scores of Rivermead Mobility Index (RMI)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: We will evaluate isometric knee flexors and extensors muscle strength using handheld dynamometer. Also, we will use hand dynamometer to measure grip strength of the affected and less affected hand while the participant is seated, with the elbow at 90-degree flexion. We will record the mean value of 3 attempts.

Measure: Change scores of Muscle Strength

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The FIM assesses the dependence level of individuals with stroke to perform 18 activities (13 motor and five cognitive tasks) in daily living. The score ranges from 18 to 126 and higher scores demonstrate greater independent participation in daily activities (Ottenbacher, Hsu, Granger, & Fiedler, 1996). The FIM has good interrater reliability and validity (Hsueh, Lin, Jeng, & Hsieh, 2002).

Measure: Change scores of Functional Independence Measure (FIM)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The Lawton IADL scale evaluates 8 activities with a score range from 0 to 8 (higher indicate better function). The inter-rater reliability and validity of the Lawton IADL have been established to be moderate to high for community-dwelling older adults (Graf, 2008; Lawton & Brody, 1969).

Measure: Change scores of Lawton Instrumental Activities of Daily Living Scale (Lawton IADL)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The SIS contains 59 items measuring eight domains, including strength, hand function, ADL/IADL, mobility, communication, emotion, memory/thinking, and participation, with a single item assessing perceived overall recovery from stroke. The total score is the average of the domain scores, and the domain scores are the averages of the item scores (1-5), and higher scores indicate better function or QOL.

Measure: Change scores of Stroke Impact Scale (SIS)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The quality of life will be assessed by the EQ-5D questionnaire which comprises the following five dimensions: mobility, self-care, usual activities, pain/discomfort and anxiety/depression. Each dimension has three levels: no problems, some problems, extreme problems. The score has been shown to be reliable and valid (Greiner et al., 2003).

Measure: Change scores of EuroQol-5D Questionnaire (EQ-5D)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The social participation level will be assessed with the Community Integration Questionnaire (CIQ).It contains 15 items to evaluate the degree of integration into each of the three area of family, social network, and productive activities. The total scores range from 0 to 29 with larger numbers indicating better integration.

Measure: Change scores of Community Integration Questionnaire (CIQ)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The Geriatric Depression Scale (GDS) - 15 items version is a self-administered questionnaire used to evaluate mood and depressive symptoms. The scores range is 0-15 and a score of 5 or greater taken as a possible indicator of depression.

Measure: Change scores of Geriatric Depression Scale (GDS)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: The Task-based EEG will be collected when participants perform the n-back task before and after the intervention program to examine the effects of training on neural plasticity.

Measure: Task-based Electroencephalogram (EEG)

Time: Baseline, posttest (an expected average of 3 months)

---

Description: Saliva samples will be collected at baseline to determine the Brain-Derived Neurotrophic Factor (BDNF) val66met genotype.

Measure: BDNF val66met genotype

Time: Baseline

---

Description: Blood samples will be collected at baseline and after the intervention programs. The blood tests will include serum BDNF level, antioxidative markers, HbA1C level, and Plasma lipid level. Serum BDNF will be quantified using an enzyme-linked immunosorbent assay (Human BDNF Quantitative Immunoassay, DBD00, R&D Systems) according to the manufacturer's instructions. This sandwich ELISA is set in order to measure natural and recombinant human mature BDNF in serum and plasma. All assays will be performed on F-bottom 96-well plates (Nunc, Wiesbaden, Germany).

Measure: Serum BDNF level

Time: Baseline, posttest (an expected average of 3 months)

---

Description: Blood samples will be collected at baseline and after the intervention programs. The blood tests will include BDNF level, antioxidative markers, HbA1C level, and Plasma lipid level. Antioxidative markers will be used to reflect the changes on oxidative stress. In particular, we will be analyzing the total antioxidant capacity (TAC).

Measure: Total antioxidant capacity (TAC)

Time: Baseline, posttest (an expected average of 3 months)

---

Description: Blood samples will be collected at baseline and after the intervention programs. The blood tests will include BDNF level, antioxidative markers, HbA1C level, and Plasma lipid level. HbA1C level will be tested to investigate the relationships between blood glucose level and aerobic exercise.

Measure: Glucose indicator

Time: Baseline, posttest (an expected average of 3 months)

---

Description: Blood samples will be collected at baseline and after the intervention programs. The blood tests will include BDNF level, antioxidative markers, HbA1C level, and Plasma lipid level. The cholesterol ratio (total cholesterol divided by high-density lipid) will be evaluated to reflect the lipid level in the blood.

Measure: Plasma lipid level

Time: Baseline, posttest (an expected average of 3 months)

---

Secondary Outcomes

Description: The Caregiver Strain Index (CSI) is a tool that can be used to quickly identify families with potential caregiving concerns. It is a 13-question tool that measures strain related to care provision. The reliability and validity has been established (Robinson, 1983).

Measure: Change scores of Caregiver Strain Index (CSI)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Description: CBS evaluates the burden of the primary caregiver of the participants, including general strain, isolation, disappointment, emotional involvement, and environment of the caregivers. The CBS for caregivers of stroke patients showed moderate to good test-retest reliability and construct validity (Elmstahl, Malmberg, & Annerstedt, 1996).

Measure: Change scores of Caregiver Burden Scale(CBS)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

---

Primary Outcomes

Description: The FESFS assesses different aspect of functioning including social functioning, productive activities and instrumental activities of daily living. Each question is rated on a Likert scale ranging from 1=Totally disagree to 4= Completely agree. The School subscale assesses the ability to meet deadlines, punctuality and school performance.

Measure: Mean change from baseline on the First-Episode Social Functioning Scale (School subscale)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The FESFS assesses different aspect of functioning including social functioning, productive activities and instrumental activities of daily living. Each question is rated on a Likert scale ranging from 1=Totally disagree to 4= Completely agree. The School subscale assesses the ability to meet deadlines, punctuality and school performance.

Measure: Mean change from baseline on the First-Episode Social Functioning Scale (School subscale)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The FESFS assesses different aspect of functioning including social functioning, productive activities and instrumental activities of daily living. Each question is rated on a Likert scale ranging from 1=Totally disagree to 4= Completely agree. The School subscale assesses the ability to meet deadlines, punctuality and school performance.

Measure: Mean change from baseline on the First-Episode Social Functioning Scale (School subscale)

Time: Baseline (T0; moment of enrollment in the study) to 1-year post-treatment (T3; one year following the end of the intervention)

---

Description: The FESFS assesses different aspect of functioning including social functioning, productive activities and instrumental activities of daily living. Each question is rated on a Likert scale ranging from 1=Totally disagree to 4= Completely agree. Relationships and social activities at school subscale assesses relationships with professors and students as well as participation in class.

Measure: Mean change from baseline on the First-Episode Social Functioning Scale (Relationships and social activities at school subscale)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The FESFS assesses different aspect of functioning including social functioning, productive activities and instrumental activities of daily living. Each question is rated on a Likert scale ranging from 1=Totally disagree to 4= Completely agree. Relationships and social activities at school subscale assesses relationships with professors and students as well as participation in class.

Measure: Mean change from baseline on the First-Episode Social Functioning Scale (Relationships and social activities at school subscale)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The FESFS assesses different aspect of functioning including social functioning, productive activities and instrumental activities of daily living. Each question is rated on a Likert scale ranging from 1=Totally disagree to 4= Completely agree. Relationships and social activities at school subscale assesses relationships with professors and students as well as participation in class.

Measure: Mean change from baseline on the First-Episode Social Functioning Scale (Relationships and social activities at school subscale)

Time: Baseline (T0; moment of enrollment in the study) to 1-year post-treatment (T3; one year following the end of the intervention)

---

Description: The Rubric tool assesses six domains of academic functioning, namely contributions, attitude, preparedness, focus on the task, professionalism and effort, and a composite score from those six scales. Based on the rating of several questions, a mean score of each domain, as well as a total score, will be obtained using a Likert scale that ranges from 1 (lowest the student can achieve) to 4 (highest the student can achieve).

Measure: Mean change from baseline on the Rubric tool

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The Rubric tool assesses six domains of academic functioning, namely contributions, attitude, preparedness, focus on the task, professionalism and effort, and a composite score from those six scales. Based on the rating of several questions, a mean score of each domain, as well as a total score, will be obtained using a Likert scale that ranges from 1 (lowest the student can achieve) to 4 (highest the student can achieve).

Measure: Mean change from baseline on the Rubric tool

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The Rubric tool assesses six domains of academic functioning, namely contributions, attitude, preparedness, focus on the task, professionalism and effort, and a composite score from those six scales. Based on the rating of several questions, a mean score of each domain, as well as a total score, will be obtained using a Likert scale that ranges from 1 (lowest the student can achieve) to 4 (highest the student can achieve).

Measure: Mean change from baseline on the Rubric tool

Time: Baseline (T0; moment of enrollment in the study) to 1-year post-treatment (T3; one year following the end of the intervention)

---

Secondary Outcomes

Description: The CVLT-II assesses verbal episodic memory. The test includes the learning of a list of words, followed by an immediate and a delayed recall.

Measure: Raw score change from baseline on the California verbal learning test-II (CVLT-II) (delayed recall).

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The CVLT-II assesses verbal episodic memory. The test includes the learning of a list of words, followed by an immediate and a delayed recall.

Measure: Raw score change from baseline on the California verbal learning test-II (CVLT-II) (delayed recall).

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The Rey complex figure test assesses visual episodic memory. The test includes the copy of a complex figure, followed by an immediate and a delayed recall.

Measure: Raw score change from baseline on the Rey Complex Figure test (delayed recall).

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The Rey complex figure test assesses visual episodic memory. The test includes the copy of a complex figure, followed by an immediate and a delayed recall.

Measure: Raw score change from baseline on the Rey Complex Figure test (delayed recall).

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The digit span subtest backward assesses verbal working memory. A series of number are read to the participant. The participant has to recall the numbers backward.

Measure: Raw score change from baseline on the digit span subtest backward of the Wechsler Adult Intelligence Scale-IV (WAIS-IV)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The digit span subtest backward assesses verbal working memory. A series of number are read to the participant. The participant has to recall the numbers backward.

Measure: Raw score change from baseline on the digit span subtest backward of the Wechsler Adult Intelligence Scale-IV (WAIS-IV)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The coding subtest assesses speed of processing. The participant has to match as many numbers as possible with symbols based on a key.

Measure: Raw score change from baseline on the coding subtest of the Wechsler Adult Intelligence Scale-IV (WAIS-IV)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The coding subtest assesses speed of processing. The participant has to match as many numbers as possible with symbols based on a key.

Measure: Raw score change from baseline on the coding subtest of the Wechsler Adult Intelligence Scale-IV (WAIS-IV)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The spatial span subtest backward assesses visual working memory. A board with blocks are presented to the participant. The assessor point series of blocks and the participant has to point the blocks backward.

Measure: Raw score change from baseline on the spatial span subtest backward of the Wechsler Memory Scale

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The spatial span subtest backward assesses visual working memory. A board with blocks are presented to the participant. The assessor point series of blocks and the participant has to point the blocks backward.

Measure: Raw score change from baseline on the spatial span subtest backward of the Wechsler Memory Scale

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The HRT-BC assesses sustained attention. Letters appear on a computer screen and the participant has to press the space bar as fast as possible, except when the letter is an "X". The HRT-BC reflects the reaction time between the six conditions of the CPT-3. In each condition, the letters are presented at a different rate. A higher HRT-BC score indicates a decrease of efficiency in information processing, which suggest difficulties in sustained attention.

Measure: Raw score change from baseline on the Hit Reaction Time Block Change (HRT-BC) of the Continuous Performance Test-3 (CPT-3)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The HRT-BC assesses sustained attention. Letters appear on a computer screen and the participant has to press the space bar as fast as possible, except when the letter is an "X". The HRT-BC reflects the reaction time between the six conditions of the CPT-3. In each condition, the letters are presented at a different rate. A higher HRT-BC score indicates a decrease of efficiency in information processing, which suggest difficulties in sustained attention.

Measure: Raw score change from baseline on the Hit Reaction Time Block Change (HRT-BC) of the Continuous Performance Test-3 (CPT-3)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The fourth condition of the Trail Making Test assesses cognitive flexibility. Letters and numbers are presented on a page.The participants has to connect these letters in alphabetical order and the numbers in numerical order while alternating between the numbers and letters

Measure: Raw score change from baseline on the fourth condition of the Trail Making Test (Delis-Kaplan Executive Function System; D-KEFS)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The fourth condition of the Trail Making Test assesses cognitive flexibility. Letters and numbers are presented on a page.The participants has to connect these letters in alphabetical order and the numbers in numerical order while alternating between the numbers and letters

Measure: Raw score change from baseline on the fourth condition of the Trail Making Test (Delis-Kaplan Executive Function System; D-KEFS)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The third condition of the color-word interference assesses inhibition. Name of color written in a different color of ink are presented to the participant. The participant has to name the color of the ink for each word as fast as possible.

Measure: Raw score change from baseline on the third condition of the color-word interference (Delis-Kaplan Executive Function System; D-KEFS)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The third condition of the color-word interference assesses inhibition. Name of color written in a different color of ink are presented to the participant. The participant has to name the color of the ink for each word as fast as possible.

Measure: Raw score change from baseline on the third condition of the color-word interference (Delis-Kaplan Executive Function System; D-KEFS)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The first condition of the verbal fluency subtest assesses phonemic fluency. The participant has to name as many word as possible in one minute that start by a given letter.

Measure: Raw score change from baseline on the verbal fluency subtest (first condition) (Delis-Kaplan Executive Function System; D-KEFS)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The first condition of the verbal fluency subtest assesses phonemic fluency. The participant has to name as many word as possible in one minute that start by a given letter.

Measure: Raw score change from baseline on the verbal fluency subtest (first condition) (Delis-Kaplan Executive Function System; D-KEFS)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The Tower of London assesses planning and organization. For this test, the assessor produces different models on his board using three beads (green, blue and red). The participant has to replicate the model using as few moves as possible.

Measure: Raw score change from baseline on the Tower of London (total item completed with the minimum movement)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The Tower of London assesses planning and organization. For this test, the assessor produces different models on his board using three beads (green, blue and red). The participant has to replicate the model using as few moves as possible.

Measure: Raw score change from baseline on the Tower of London (total item completed with the minimum movement)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The Matrix reasoning subtest assesses perceptual reasoning. Series of complex patterns are presented to the participant. The participant has to choose the logical end to each pattern.

Measure: Raw score change from baseline on the Matrix subtest of the Wechsler Adult Intelligence Scale-IV (WAIS-IV)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The Matrix reasoning subtest assesses perceptual reasoning. Series of complex patterns are presented to the participant. The participant has to choose the logical end to each pattern.

Measure: Raw score change from baseline on the Matrix subtest of the Wechsler Adult Intelligence Scale-IV (WAIS-IV)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The Combined stories test assesses theory of mind. Short stories are presented to the participant and questions regarding the mental states of the characters are asked.

Measure: Raw score change from baseline on the Combined Stories test

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The Combined stories test assesses theory of mind. Short stories are presented to the participant and questions regarding the mental states of the characters are asked.

Measure: Raw score change from baseline on the Combined Stories test

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The Social Knowledge test assess social perception. Situations of daily life are presented to the participant. The participant is asked to state the emotion that would be felt by most people in that situation.

Measure: Raw score change from baseline on the Social Knowledge test

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The Social Knowledge test assess social perception. Situations of daily life are presented to the participant. The participant is asked to state the emotion that would be felt by most people in that situation.

Measure: Raw score change from baseline on the Social Knowledge test

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The Penn Emotion Recognition task assesses emotion recognition. Faces expressing emotions are presented on a computer screen. The participant has to determine the emotion expressed by the character among the seven choices.

Measure: Raw score change from baseline on the Penn Emotion Recognition task

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The Penn Emotion Recognition task assesses emotion recognition. Faces expressing emotions are presented on a computer screen. The participant has to determine the emotion expressed by the character among the seven choices.

Measure: Raw score change from baseline on the Penn Emotion Recognition task

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The Échelle de Répercussion Fonctionnelle assesses functional impact of cognitive deficits in daily living using a semi-structured interview. The severity of the functional impact is rated on a Likert scale from 1= no impact to 7=important impact.

Measure: Raw score change from baseline on the Échelle de Répercussion Fonctionnelle

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The Échelle de Répercussion Fonctionnelle assesses functional impact of cognitive deficits in daily living using a semi-structured interview. The severity of the functional impact is rated on a Likert scale from 1= no impact to 7=important impact.

Measure: Raw score change from baseline on the Échelle de Répercussion Fonctionnelle

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The PANSS is a semi-structured interview that assess clinical symptoms of psychotic disorder, including positive symptoms, negative symptoms and general psychopathology.

Measure: Raw score change from baseline on the Positive And Negative Syndrome Scale (PANSS)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The PANSS is a semi-structured interview that assess clinical symptoms of psychotic disorder, including positive symptoms, negative symptoms and general psychopathology.

Measure: Raw score change from baseline on the Positive And Negative Syndrome Scale (PANSS)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The SERS assesses self-esteem. The questionnaire includes 20 questions rated on a Likert scale from 1=Never to 7=Always

Measure: Raw score change from baseline on the Self-Esteem Rating Scale (SERS)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The SERS assesses self-esteem. The questionnaire includes 20 questions rated on a Likert scale from 1=Never to 7=Always

Measure: Raw score change from baseline on the Self-Esteem Rating Scale (SERS)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The SSTICS assesses metacognitive knowledge, i.e., participant' perceptions of his cognitive abilities. The questionnaire includes 21 questions rated on a Likert scale ranging from 0=Never to 4=very often.

Measure: Raw score change from baseline on the Subjective Scale to Investigate Cognition in Schizophrenia (SSTICS)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The SSTICS assesses metacognitive knowledge, i.e., participant' perceptions of his cognitive abilities. The questionnaire includes 21 questions rated on a Likert scale ranging from 0=Never to 4=very often.

Measure: Raw score change from baseline on the Subjective Scale to Investigate Cognition in Schizophrenia (SSTICS)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The FESFS assesses different aspect of functioning including social functioning, productive activities and instrumental activities of daily living. Each question is rated on a Likert scale ranging from 1=Totally disagree to 4= Completely agree

Measure: Raw score change from baseline on the First-Episode Social Functioning Scale (FESFS)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The FESFS assesses different aspect of functioning including social functioning, productive activities and instrumental activities of daily living. Each question is rated on a Likert scale ranging from 1=Totally disagree to 4= Completely agree

Measure: Raw score change from baseline on the First-Episode Social Functioning Scale (FESFS)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: The CTQ assesses adverse events experienced during childhood and adolescence. The CTQ includes 70 items rated on a Likert scale ranging from 1=Never true to 5=very often true

Measure: Raw score change from baseline on the Childhood Trauma Questionnaire (CTQ)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: The CTQ assesses adverse events experienced during childhood and adolescence. The CTQ includes 70 items rated on a Likert scale ranging from 1=Never true to 5=very often true

Measure: Raw score change from baseline on the Childhood Trauma Questionnaire (CTQ)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: Presence or absence of a genetic variant (Met66Met) of the BDNF gene (Val66Met).

Measure: Presence or absence of a genetic variant (Met66Met) of the Brain-derived neurotrophic factor (BDNF) gene (Val66Met) at baseline

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: Presence or absence of a genetic variant (Met66Met) of the BDNF gene (Val66Met).

Measure: Presence or absence of a genetic variant (Met66Met) of the Brain-derived neurotrophic factor (BDNF) gene (Val66Met) at baseline

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Description: Single nucleotide polymorphisms (SNP) in the 3' end of the COMT gene and the Val158Met polymorphism

Measure: Presence or absence of the Val158Met polymorphism on the Catechol-O-Methyltransferase (COMT) gene

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

---

Description: Single nucleotide polymorphisms (SNP) in the 3' end of the COMT gene and the Val158Met polymorphism

Measure: Presence or absence of the Val158Met polymorphism on the Catechol-O-Methyltransferase (COMT) gene

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

---

Primary Outcomes

Description: To examine presynaptic striatal DA availability (in dorsal putamen) using PET imaging method with the 18F-dopa - [18F]fluorodopa uptake. The recordings will be expressed in Ki ref values [Ki ref] and Standard Uptake Values [SUV].

Measure: Positron Emission Tomography (PET) with 18F-dopa - PET imaging with [18F]fluorodopa uptake.

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

---

Description: To examine presynaptic striatal DA availability (in dorsal putamen) using PET imaging method with the 18F-dopa - [18F]fluorodopa uptake. The recordings will be expressed in Ki ref values [Ki ref] and Standard Uptake Values [SUV].

Measure: Positron Emission Tomography (PET) with 18F-dopa - PET imaging with [18F]fluorodopa uptake.

Time: 1-week Post-HIIT 1

---

Description: To examine presynaptic striatal DA availability (in dorsal putamen) using PET imaging method with the 18F-dopa - [18F]fluorodopa uptake. The recordings will be expressed in Ki ref values [Ki ref] and Standard Uptake Values [SUV].

Measure: Positron Emission Tomography (PET) with 18F-dopa - PET imaging with [18F]fluorodopa uptake.

Time: 3-months Post-HIIT 2

---

Description: To evaluate neurophysiological functions of brain subcortical and cortical structures using MRI scanner. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The image recordings will express metabolic brain activity as expressed in fMRI response [% BOLD signal].

Measure: functional Magnetic Resonance Imaging (fMRI) - metabolic activity of brain recorded with MRI scanner.

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

---

Description: To evaluate neurophysiological functions of brain subcortical and cortical structures using MRI scanner. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The image recordings will express metabolic brain activity as expressed in fMRI response [% BOLD signal].

Measure: functional Magnetic Resonance Imaging (fMRI) - metabolic activity of brain recorded with MRI scanner.

Time: 1-week Post-HIIT 1

---

Description: To evaluate neurophysiological functions of brain subcortical and cortical structures using MRI scanner. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The image recordings will express metabolic brain activity as expressed in fMRI response [% BOLD signal].

Measure: functional Magnetic Resonance Imaging (fMRI) - metabolic activity of brain recorded with MRI scanner.

Time: 3-months Post-HIIT 2

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as an amplitude of event related potentials and expressed in microvolts [µV].

Measure: Electroencephalography (EEG) - amplitude of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT1 starts

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as an amplitude of event related potentials and expressed in microvolts [µV].

Measure: Electroencephalography (EEG) - amplitude of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 1-week Post-HIIT 1

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as an amplitude of event related potentials and expressed in microvolts [µV].

Measure: Electroencephalography (EEG) - amplitude of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 1.5-month Post-HIIT 1

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as an amplitude of event related potentials and expressed in microvolts [µV].

Measure: Electroencephalography (EEG) - amplitude of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 3-months Post-HIIT 1

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as an amplitude of event related potentials and expressed in microvolts [µV].

Measure: Electroencephalography (EEG) - amplitude of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 1-week Post-HIIT 2

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as an amplitude of event related potentials and expressed in microvolts [µV].

Measure: Electroencephalography (EEG) - amplitude of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 1.5-month Post-HIIT 2

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as an amplitude of event related potentials and expressed in microvolts [µV].

Measure: Electroencephalography (EEG) - amplitude of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 3-months Post-HIIT 2

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as a latency of event related potentials and expressed in milliseconds [ms].

Measure: Electroencephalography (EEG) - latency of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT1 starts

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as a latency of event related potentials and expressed in milliseconds [ms].

Measure: Electroencephalography (EEG) - latency of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 1-week Post-HIIT 1

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as a latency of event related potentials and expressed in milliseconds [ms].

Measure: Electroencephalography (EEG) - latency of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 1.5-month Post-HIIT 1

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as a latency of event related potentials and expressed in milliseconds [ms].

Measure: Electroencephalography (EEG) - latency of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 3-months Post-HIIT 1

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as a latency of event related potentials and expressed in milliseconds [ms].

Measure: Electroencephalography (EEG) - latency of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 1-week Post-HIIT 2

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as a latency of event related potentials and expressed in milliseconds [ms].

Measure: Electroencephalography (EEG) - latency of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 1.5-month Post-HIIT 2

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as a latency of event related potentials and expressed in milliseconds [ms].

Measure: Electroencephalography (EEG) - latency of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 3-months Post-HIIT 2

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as the EEG power in the beta-band (≈13-35 Hz) and expressed in decibels [dB].

Measure: Electroencephalography (EEG) - EEG power in the beta-band recorded from scalp using surface electrodes.

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT1 starts

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as the EEG power in the beta-band (≈13-35 Hz) and expressed in decibels [dB].

Measure: Electroencephalography (EEG) - EEG power in the beta-band recorded from scalp using surface electrodes.

Time: 1-week Post-HIIT 1

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as the EEG power in the beta-band (≈13-35 Hz) and expressed in decibels [dB].

Measure: Electroencephalography (EEG) - EEG power in the beta-band recorded from scalp using surface electrodes.

Time: 1.5-month Post-HIIT 1

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as the EEG power in the beta-band (≈13-35 Hz) and expressed in decibels [dB].

Measure: Electroencephalography (EEG) - EEG power in the beta-band recorded from scalp using surface electrodes.

Time: 3-months Post-HIIT 1

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as the EEG power in the beta-band (≈13-35 Hz) and expressed in decibels [dB].

Measure: Electroencephalography (EEG) - EEG power in the beta-band recorded from scalp using surface electrodes.

Time: 1-week Post-HIIT 2

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as the EEG power in the beta-band (≈13-35 Hz) and expressed in decibels [dB].

Measure: Electroencephalography (EEG) - EEG power in the beta-band recorded from scalp using surface electrodes.

Time: 1.5-month Post-HIIT 2

---

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as the EEG power in the beta-band (≈13-35 Hz) and expressed in decibels [dB].

Measure: Electroencephalography (EEG) - EEG power in the beta-band recorded from scalp using surface electrodes.

Time: 3-months Post-HIIT 2

---

Description: To evaluate neurophysiological functions of muscles engaged in an activity (hand muscles), electromyography (EMG - recordings of electrical activity of skeletal muscles) will be collected using surface electrodes, during index finger motor tasks and at rest. The recordings will be expressed in millivolts [mV].

Measure: Electromyography (EMG) - recordings of electrical activity of skeletal muscles using surface electrodes.

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

---

Description: To evaluate neurophysiological functions of muscles engaged in an activity (hand muscles), electromyography (EMG - recordings of electrical activity of skeletal muscles) will be collected using surface electrodes, during index finger motor tasks and at rest. The recordings will be expressed in millivolts [mV].

Measure: Electromyography (EMG) - recordings of electrical activity of skeletal muscles using surface electrodes.

Time: 1-week Post-HIIT 1

---

Description: To evaluate neurophysiological functions of muscles engaged in an activity (hand muscles), electromyography (EMG - recordings of electrical activity of skeletal muscles) will be collected using surface electrodes, during index finger motor tasks and at rest. The recordings will be expressed in millivolts [mV].

Measure: Electromyography (EMG) - recordings of electrical activity of skeletal muscles using surface electrodes.

Time: 1.5-month Post-HIIT 1

---

Description: To evaluate neurophysiological functions of muscles engaged in an activity (hand muscles), electromyography (EMG - recordings of electrical activity of skeletal muscles) will be collected using surface electrodes, during index finger motor tasks and at rest. The recordings will be expressed in millivolts [mV].

Measure: Electromyography (EMG) - recordings of electrical activity of skeletal muscles using surface electrodes.

Time: 3-months Post-HIIT 1

---

Description: To evaluate neurophysiological functions of muscles engaged in an activity (hand muscles), electromyography (EMG - recordings of electrical activity of skeletal muscles) will be collected using surface electrodes, during index finger motor tasks and at rest. The recordings will be expressed in millivolts [mV].

Measure: Electromyography (EMG) - recordings of electrical activity of skeletal muscles using surface electrodes.

Time: 1-week Post-HIIT 2

---

Description: To evaluate neurophysiological functions of muscles engaged in an activity (hand muscles), electromyography (EMG - recordings of electrical activity of skeletal muscles) will be collected using surface electrodes, during index finger motor tasks and at rest. The recordings will be expressed in millivolts [mV].

Measure: Electromyography (EMG) - recordings of electrical activity of skeletal muscles using surface electrodes.

Time: 1.5-month Post-HIIT 2

---

Description: To evaluate neurophysiological functions of muscles engaged in an activity (hand muscles), electromyography (EMG - recordings of electrical activity of skeletal muscles) will be collected using surface electrodes, during index finger motor tasks and at rest. The recordings will be expressed in millivolts [mV].

Measure: Electromyography (EMG) - recordings of electrical activity of skeletal muscles using surface electrodes.

Time: 3-months Post-HIIT 2

---

Description: To evaluate executive function and bimanual dexterity. The Purdue Pegboard consists of a test board, score sheets and elements to work with: pins, collars, washers. Subjects are instructed to insert pins to holes in the board or build the sets with the elements in a fixed time. The final score is the number of pins inserted or built sets [number of pins or sets].

Measure: Purdue Pegboard Test (PPT) - neuropsychological test

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

---

Description: To evaluate executive function and bimanual dexterity. The Purdue Pegboard consists of a test board, score sheets and elements to work with: pins, collars, washers. Subjects are instructed to insert pins to holes in the board or build the sets with the elements in a fixed time. The final score is the number of pins inserted or built sets [number of pins or sets].

Measure: Purdue Pegboard Test (PPT) - neuropsychological test

Time: 1-week Post-HIIT 1

---

Description: To evaluate executive function and bimanual dexterity. The Purdue Pegboard consists of a test board, score sheets and elements to work with: pins, collars, washers. Subjects are instructed to insert pins to holes in the board or build the sets with the elements in a fixed time. The final score is the number of pins inserted or built sets [number of pins or sets].

Measure: Purdue Pegboard Test (PPT) - neuropsychological test

Time: 1.5-month Post-HIIT 1

---

Description: To evaluate executive function and bimanual dexterity. The Purdue Pegboard consists of a test board, score sheets and elements to work with: pins, collars, washers. Subjects are instructed to insert pins to holes in the board or build the sets with the elements in a fixed time. The final score is the number of pins inserted or built sets [number of pins or sets].

Measure: Purdue Pegboard Test (PPT) - neuropsychological test

Time: 3-months Post-HIIT 1

---

Description: To evaluate executive function and bimanual dexterity. The Purdue Pegboard consists of a test board, score sheets and elements to work with: pins, collars, washers. Subjects are instructed to insert pins to holes in the board or build the sets with the elements in a fixed time. The final score is the number of pins inserted or built sets [number of pins or sets].

Measure: Purdue Pegboard Test (PPT) - neuropsychological test

Time: 1-week Post-HIIT 2

---

Description: To evaluate executive function and bimanual dexterity. The Purdue Pegboard consists of a test board, score sheets and elements to work with: pins, collars, washers. Subjects are instructed to insert pins to holes in the board or build the sets with the elements in a fixed time. The final score is the number of pins inserted or built sets [number of pins or sets].

Measure: Purdue Pegboard Test (PPT) - neuropsychological test

Time: 1.5-month Post-HIIT 2

---

Description: To evaluate executive function and bimanual dexterity. The Purdue Pegboard consists of a test board, score sheets and elements to work with: pins, collars, washers. Subjects are instructed to insert pins to holes in the board or build the sets with the elements in a fixed time. The final score is the number of pins inserted or built sets [number of pins or sets].

Measure: Purdue Pegboard Test (PPT) - neuropsychological test

Time: 3-months Post-HIIT 2

---

Description: TMT-A is a psychological measure of cognitive processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-A - trail making test, part A

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

---

Description: TMT-A is a psychological measure of cognitive processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-A - trail making test, part A

Time: 1-week Post-HIIT 1

---

Description: TMT-A is a psychological measure of cognitive processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-A - trail making test, part A

Time: 1.5-month Post-HIIT 1

---

Description: TMT-A is a psychological measure of cognitive processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-A - trail making test, part A

Time: 3-months Post-HIIT 1

---

Description: TMT-A is a psychological measure of cognitive processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-A - trail making test, part A

Time: 1-week Post-HIIT 2

---

Description: TMT-A is a psychological measure of cognitive processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-A - trail making test, part A

Time: 1.5-month Post-HIIT 2

---

Description: TMT-A is a psychological measure of cognitive processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-A - trail making test, part A

Time: 3-months Post-HIIT 2

---

Description: TMT-B is a psychological measure of executive function, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-B - trail making test, part B

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT1 starts

---

Description: TMT-B is a psychological measure of executive function, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-B - trail making test, part B

Time: 1-week Post-HIIT 1

---

Description: TMT-B is a psychological measure of executive function, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-B - trail making test, part B

Time: 1.5-month Post-HIIT 1

---

Description: TMT-B is a psychological measure of executive function, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-B - trail making test, part B

Time: 3-months Post-HIIT 1

---

Description: TMT-B is a psychological measure of executive function, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-B - trail making test, part B

Time: 1-week Post-HIIT 2

---

Description: TMT-B is a psychological measure of executive function, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-B - trail making test, part B

Time: 1.5-month Post-HIIT 2

---

Description: TMT-B is a psychological measure of executive function, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-B - trail making test, part B

Time: 3-months Post-HIIT 2

---

Description: ST-I is used as a psychological measure of processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-I - Stroop Test, part I

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

---

Description: ST-I is used as a psychological measure of processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-I - Stroop Test, part I

Time: 1-week Post-HIIT 1

---

Description: ST-I is used as a psychological measure of processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-I - Stroop Test, part I

Time: 1.5-month Post-HIIT 1

---

Description: ST-I is used as a psychological measure of processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-I - Stroop Test, part I

Time: 3-months Post-HIIT 1

---

Description: ST-I is used as a psychological measure of processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-I - Stroop Test, part I

Time: 1-week Post-HIIT 2

---

Description: ST-I is used as a psychological measure of processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-I - Stroop Test, part I

Time: 1.5-month Post-HIIT 2

---

Description: ST-I is used as a psychological measure of processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-I - Stroop Test, part I

Time: 3-months Post-HIIT 2

---

Description: ST-II is used as a psychological measure of selective attention and inhibition, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-II - Stroop Test, part II

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

---

Description: ST-II is used as a psychological measure of selective attention and inhibition, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-II - Stroop Test, part II

Time: 1-week Post-HIIT 1

---

Description: ST-II is used as a psychological measure of selective attention and inhibition, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-II - Stroop Test, part II

Time: 1.5-month Post-HIIT 1

---

Description: ST-II is used as a psychological measure of selective attention and inhibition, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-II - Stroop Test, part II

Time: 3-months Post-HIIT 1

---

Description: ST-II is used as a psychological measure of selective attention and inhibition, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-II - Stroop Test, part II

Time: 1-week Post-HIIT 2

---

Description: ST-II is used as a psychological measure of selective attention and inhibition, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-II - Stroop Test, part II

Time: 1.5-month Post-HIIT 2

---

Description: ST-II is used as a psychological measure of selective attention and inhibition, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-II - Stroop Test, part II

Time: 3-months Post-HIIT 2

---

Description: Motor and non-motor Parkinson's disease signs/symptoms will be evaluated using UPDRS (sections I - III, that include the items 1 -31). Each item is expressed in [points] from 0 to 4 points, with an interpretation that the higher value means the severe accentuation of sign/symptom. The total score will be reported, as the sum of the points of the sections I-III (the score in the range 0 - 176 points) and each section's score will be reported as well, i.e.: the sum of the points of the section I (sum of points for items 1-4 in the range 0 - 16 points), the sum of the points of the section II (sum of points for items 5-17 in the range 0 - 52 points), the sum of the points of the section III (sum of points for items 18-31 in the range 0 - 108 points).

Measure: UPDRS - unified Parkinson's disease rating scale

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

---

Description: Motor and non-motor Parkinson's disease signs/symptoms will be evaluated using UPDRS (sections I - III, that include the items 1 -31). Each item is expressed in [points] from 0 to 4 points, with an interpretation that the higher value means the severe accentuation of sign/symptom. The total score will be reported, as the sum of the points of the sections I-III (the score in the range 0 - 176 points) and each section's score will be reported as well, i.e.: the sum of the points of the section I (sum of points for items 1-4 in the range 0 - 16 points), the sum of the points of the section II (sum of points for items 5-17 in the range 0 - 52 points), the sum of the points of the section III (sum of points for items 18-31 in the range 0 - 108 points).

Measure: UPDRS - unified Parkinson's disease rating scale

Time: 1-week Post-HIIT 1

---

Description: Motor and non-motor Parkinson's disease signs/symptoms will be evaluated using UPDRS (sections I - III, that include the items 1 -31). Each item is expressed in [points] from 0 to 4 points, with an interpretation that the higher value means the severe accentuation of sign/symptom. The total score will be reported, as the sum of the points of the sections I-III (the score in the range 0 - 176 points) and each section's score will be reported as well, i.e.: the sum of the points of the section I (sum of points for items 1-4 in the range 0 - 16 points), the sum of the points of the section II (sum of points for items 5-17 in the range 0 - 52 points), the sum of the points of the section III (sum of points for items 18-31 in the range 0 - 108 points).

Measure: UPDRS - unified Parkinson's disease rating scale

Time: 1.5-month Post-HIIT 1

---

Description: Motor and non-motor Parkinson's disease signs/symptoms will be evaluated using UPDRS (sections I - III, that include the items 1 -31). Each item is expressed in [points] from 0 to 4 points, with an interpretation that the higher value means the severe accentuation of sign/symptom. The total score will be reported, as the sum of the points of the sections I-III (the score in the range 0 - 176 points) and each section's score will be reported as well, i.e.: the sum of the points of the section I (sum of points for items 1-4 in the range 0 - 16 points), the sum of the points of the section II (sum of points for items 5-17 in the range 0 - 52 points), the sum of the points of the section III (sum of points for items 18-31 in the range 0 - 108 points).

Measure: UPDRS - unified Parkinson's disease rating scale

Time: 3-months Post-HIIT 1

---

Description: Motor and non-motor Parkinson's disease signs/symptoms will be evaluated using UPDRS (sections I - III, that include the items 1 -31). Each item is expressed in [points] from 0 to 4 points, with an interpretation that the higher value means the severe accentuation of sign/symptom. The total score will be reported, as the sum of the points of the sections I-III (the score in the range 0 - 176 points) and each section's score will be reported as well, i.e.: the sum of the points of the section I (sum of points for items 1-4 in the range 0 - 16 points), the sum of the points of the section II (sum of points for items 5-17 in the range 0 - 52 points), the sum of the points of the section III (sum of points for items 18-31 in the range 0 - 108 points).

Measure: UPDRS - unified Parkinson's disease rating scale

Time: 1-week Post-HIIT 2

---

Description: Motor and non-motor Parkinson's disease signs/symptoms will be evaluated using UPDRS (sections I - III, that include the items 1 -31). Each item is expressed in [points] from 0 to 4 points, with an interpretation that the higher value means the severe accentuation of sign/symptom. The total score will be reported, as the sum of the points of the sections I-III (the score in the range 0 - 176 points) and each section's score will be reported as well, i.e.: the sum of the points of the section I (sum of points for items 1-4 in the range 0 - 16 points), the sum of the points of the section II (sum of points for items 5-17 in the range 0 - 52 points), the sum of the points of the section III (sum of points for items 18-31 in the range 0 - 108 points).

Measure: UPDRS - unified Parkinson's disease rating scale

Time: 1.5-month Post-HIIT 2

---

Description: Motor and non-motor Parkinson's disease signs/symptoms will be evaluated using UPDRS (sections I - III, that include the items 1 -31). Each item is expressed in [points] from 0 to 4 points, with an interpretation that the higher value means the severe accentuation of sign/symptom. The total score will be reported, as the sum of the points of the sections I-III (the score in the range 0 - 176 points) and each section's score will be reported as well, i.e.: the sum of the points of the section I (sum of points for items 1-4 in the range 0 - 16 points), the sum of the points of the section II (sum of points for items 5-17 in the range 0 - 52 points), the sum of the points of the section III (sum of points for items 18-31 in the range 0 - 108 points).

Measure: UPDRS - unified Parkinson's disease rating scale

Time: 3-months Post-HIIT 2

---

Description: BDNF secretion level in blood expressed in [pg/mL]

Measure: BDNF - brain derived neurotrophic factor

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

---

Description: BDNF secretion level in blood expressed in [pg/mL]

Measure: BDNF - brain derived neurotrophic factor

Time: 1-week Post-HIIT 1

---

Description: BDNF secretion level in blood expressed in [pg/mL]

Measure: BDNF - brain derived neurotrophic factor

Time: 1.5-month Post-HIIT 1

---

Description: BDNF secretion level in blood expressed in [pg/mL]

Measure: BDNF - brain derived neurotrophic factor

Time: 3-months Post-HIIT 1

---

Description: BDNF secretion level in blood expressed in [pg/mL]

Measure: BDNF - brain derived neurotrophic factor

Time: 1-week Post-HIIT 2

---

Description: BDNF secretion level in blood expressed in [pg/mL]

Measure: BDNF - brain derived neurotrophic factor

Time: 1.5-month Post-HIIT 2

---

Description: BDNF secretion level in blood expressed in [pg/mL]

Measure: BDNF - brain derived neurotrophic factor

Time: 3-months Post-HIIT 2

---

Description: NGF secretion level in blood expressed in [pg/mL]

Measure: NGF - nerve growth factor

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

---

Description: NGF secretion level in blood expressed in [pg/mL]

Measure: NGF - nerve growth factor

Time: 1-week Post-HIIT 1

---

Description: NGF secretion level in blood expressed in [pg/mL]

Measure: NGF - nerve growth factor

Time: 1.5-month Post-HIIT 1

---

Description: NGF secretion level in blood expressed in [pg/mL]

Measure: NGF - nerve growth factor

Time: 3-months Post-HIIT 1

---

Description: NGF secretion level in blood expressed in [pg/mL]

Measure: NGF - nerve growth factor

Time: 1-week Post-HIIT 2

---

Description: NGF secretion level in blood expressed in [pg/mL]

Measure: NGF - nerve growth factor

Time: 1.5-month Post-HIIT 2

---

Description: NGF secretion level in blood expressed in [pg/mL]

Measure: NGF - nerve growth factor

Time: 3-months Post-HIIT 2

---

Description: IGF 1 secretion level in blood expressed in [pg/mL]

Measure: IGF 1 - insulin-like growth factor 1

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

---

Description: IGF 1 secretion level in blood expressed in [pg/mL]

Measure: IGF 1 - insulin-like growth factor 1

Time: 1-week Post-HIIT 1

---

Description: IGF 1 secretion level in blood expressed in [pg/mL]

Measure: IGF 1 - insulin-like growth factor 1

Time: 1.5-month Post-HIIT 1

---

Description: IGF 1 secretion level in blood expressed in [pg/mL]

Measure: IGF 1 - insulin-like growth factor 1

Time: 3-months Post-HIIT 1

---

Description: IGF 1 secretion level in blood expressed in [pg/mL]

Measure: IGF 1 - insulin-like growth factor 1

Time: 1-week Post-HIIT 2

---

Description: IGF 1 secretion level in blood expressed in [pg/mL]

Measure: IGF 1 - insulin-like growth factor 1

Time: 1.5-month Post-HIIT 2

---

Description: IGF 1 secretion level in blood expressed in [pg/mL]

Measure: IGF 1 - insulin-like growth factor 1

Time: 3-months Post-HIIT 2

---

Description: The single nucleotide polymorphism (SNP) BDNF Val66Met variant (rs 6265) will be genotyped by using the TaqMan SNP genotyping assay. Thermal cycling and end-point PCR (polymerase chain reaction) analysis will be performed on the Rotor-Gene Q 5plex real-time PCR Cycler and will be analyzed by Q-Rex-software. Genotype of BDNF polymorphism will be expressed in percentge values [% of genotype].

Measure: Val66Met polymorphism of BDNF - genotyping of BDNF polymorphism

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

---

Secondary Outcomes

Description: Parkinson's disease stage evaluation using H&Y scale, expressed in [points] from 1 to 5 points. The modified version of the H&Y scale will be used, in which: the score 1 means - unilateral involvement only; the score 1.5 means - unilateral and axial involvement; the score 2 means - bilateral involvement without impairment of balance; the score 2.5 means - mild bilateral disease with recovery on pull test; the score 3 means - mild to moderate bilateral disease, some postural instability, physically independent; the score 4 means - severe disability, still able to walk or stand unassisted; the score 5 means - wheelchair bound or bedridden unless aided.

Measure: H&Y scale - Hoehn and Yahr scale

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

---

Description: Parkinson's disease stage evaluation using H&Y scale, expressed in [points] from 1 to 5 points. The modified version of the H&Y scale will be used, in which: the score 1 means - unilateral involvement only; the score 1.5 means - unilateral and axial involvement; the score 2 means - bilateral involvement without impairment of balance; the score 2.5 means - mild bilateral disease with recovery on pull test; the score 3 means - mild to moderate bilateral disease, some postural instability, physically independent; the score 4 means - severe disability, still able to walk or stand unassisted; the score 5 means - wheelchair bound or bedridden unless aided.

Measure: H&Y scale - Hoehn and Yahr scale

Time: 1-week Post-HIIT 1

---

Description: Parkinson's disease stage evaluation using H&Y scale, expressed in [points] from 1 to 5 points. The modified version of the H&Y scale will be used, in which: the score 1 means - unilateral involvement only; the score 1.5 means - unilateral and axial involvement; the score 2 means - bilateral involvement without impairment of balance; the score 2.5 means - mild bilateral disease with recovery on pull test; the score 3 means - mild to moderate bilateral disease, some postural instability, physically independent; the score 4 means - severe disability, still able to walk or stand unassisted; the score 5 means - wheelchair bound or bedridden unless aided.

Measure: H&Y scale - Hoehn and Yahr scale

Time: 1.5-month Post-HIIT 1

---

Description: Parkinson's disease stage evaluation using H&Y scale, expressed in [points] from 1 to 5 points. The modified version of the H&Y scale will be used, in which: the score 1 means - unilateral involvement only; the score 1.5 means - unilateral and axial involvement; the score 2 means - bilateral involvement without impairment of balance; the score 2.5 means - mild bilateral disease with recovery on pull test; the score 3 means - mild to moderate bilateral disease, some postural instability, physically independent; the score 4 means - severe disability, still able to walk or stand unassisted; the score 5 means - wheelchair bound or bedridden unless aided.

Measure: H&Y scale - Hoehn and Yahr scale

Time: 3-months Post-HIIT 1

---

Description: Parkinson's disease stage evaluation using H&Y scale, expressed in [points] from 1 to 5 points. The modified version of the H&Y scale will be used, in which: the score 1 means - unilateral involvement only; the score 1.5 means - unilateral and axial involvement; the score 2 means - bilateral involvement without impairment of balance; the score 2.5 means - mild bilateral disease with recovery on pull test; the score 3 means - mild to moderate bilateral disease, some postural instability, physically independent; the score 4 means - severe disability, still able to walk or stand unassisted; the score 5 means - wheelchair bound or bedridden unless aided.

Measure: H&Y scale - Hoehn and Yahr scale

Time: 1-week Post-HIIT 2

---

Description: Parkinson's disease stage evaluation using H&Y scale, expressed in [points] from 1 to 5 points. The modified version of the H&Y scale will be used, in which: the score 1 means - unilateral involvement only; the score 1.5 means - unilateral and axial involvement; the score 2 means - bilateral involvement without impairment of balance; the score 2.5 means - mild bilateral disease with recovery on pull test; the score 3 means - mild to moderate bilateral disease, some postural instability, physically independent; the score 4 means - severe disability, still able to walk or stand unassisted; the score 5 means - wheelchair bound or bedridden unless aided.

Measure: H&Y scale - Hoehn and Yahr scale

Time: 1.5-month Post-HIIT 2

---

Description: Parkinson's disease stage evaluation using H&Y scale, expressed in [points] from 1 to 5 points. The modified version of the H&Y scale will be used, in which: the score 1 means - unilateral involvement only; the score 1.5 means - unilateral and axial involvement; the score 2 means - bilateral involvement without impairment of balance; the score 2.5 means - mild bilateral disease with recovery on pull test; the score 3 means - mild to moderate bilateral disease, some postural instability, physically independent; the score 4 means - severe disability, still able to walk or stand unassisted; the score 5 means - wheelchair bound or bedridden unless aided.

Measure: H&Y scale - Hoehn and Yahr scale

Time: 3-months Post-HIIT 2

---

Description: S&E DLA scale measure of daily function of Parkinson's disease patients, expressed in [%] from 100 to 0 % (with the higher % value as the better score). The 100% score means that the person is completely independent; able to do all chores without slowness, difficulty or impairment; essentially normal; unaware of any difficulty. The 0% score describes the person bedridden with the only vegetative functions such as swallowing; bladder and bowel functions are not functioning.

Measure: S&E DLA scale - Schwab and England Daily Living Activity Scale

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

---

Description: S&E DLA scale measure of daily function of Parkinson's disease patients, expressed in [%] from 100 to 0 % (with the higher % value as the better score). The 100% score means that the person is completely independent; able to do all chores without slowness, difficulty or impairment; essentially normal; unaware of any difficulty. The 0% score describes the person bedridden with the only vegetative functions such as swallowing; bladder and bowel functions are not functioning.

Measure: S&E DLA scale - Schwab and England Daily Living Activity Scale

Time: 1-week Post-HIIT 1

---

Description: S&E DLA scale measure of daily function of Parkinson's disease patients, expressed in [%] from 100 to 0 % (with the higher % value as the better score). The 100% score means that the person is completely independent; able to do all chores without slowness, difficulty or impairment; essentially normal; unaware of any difficulty. The 0% score describes the person bedridden with the only vegetative functions such as swallowing; bladder and bowel functions are not functioning.

Measure: S&E DLA scale - Schwab and England Daily Living Activity Scale

Time: 1.5-month Post-HIIT 1

---

Description: S&E DLA scale measure of daily function of Parkinson's disease patients, expressed in [%] from 100 to 0 % (with the higher % value as the better score). The 100% score means that the person is completely independent; able to do all chores without slowness, difficulty or impairment; essentially normal; unaware of any difficulty. The 0% score describes the person bedridden with the only vegetative functions such as swallowing; bladder and bowel functions are not functioning.

Measure: S&E DLA scale - Schwab and England Daily Living Activity Scale

Time: 3-months Post-HIIT 1

---

Description: S&E DLA scale measure of daily function of Parkinson's disease patients, expressed in [%] from 100 to 0 % (with the higher % value as the better score). The 100% score means that the person is completely independent; able to do all chores without slowness, difficulty or impairment; essentially normal; unaware of any difficulty. The 0% score describes the person bedridden with the only vegetative functions such as swallowing; bladder and bowel functions are not functioning.

Measure: S&E DLA scale - Schwab and England Daily Living Activity Scale

Time: 1-week Post-HIIT 2

---

Description: S&E DLA scale measure of daily function of Parkinson's disease patients, expressed in [%] from 100 to 0 % (with the higher % value as the better score). The 100% score means that the person is completely independent; able to do all chores without slowness, difficulty or impairment; essentially normal; unaware of any difficulty. The 0% score describes the person bedridden with the only vegetative functions such as swallowing; bladder and bowel functions are not functioning.

Measure: S&E DLA scale - Schwab and England Daily Living Activity Scale

Time: 1.5-month Post-HIIT 2

---

Description: S&E DLA scale measure of daily function of Parkinson's disease patients, expressed in [%] from 100 to 0 % (with the higher % value as the better score). The 100% score means that the person is completely independent; able to do all chores without slowness, difficulty or impairment; essentially normal; unaware of any difficulty. The 0% score describes the person bedridden with the only vegetative functions such as swallowing; bladder and bowel functions are not functioning.

Measure: S&E DLA scale - Schwab and England Daily Living Activity Scale

Time: 3-months Post-HIIT 2

---

Description: MMSE will be used to to exclude the Parkinson's disease patients with cognitive impairment, expressed in [points]in the range from 0 to 30 points. It is an 11-question measure that tests five areas of cognitive function: orientation, registration, attention and calculation, recall, and language. A score of 23 or lower is indicative of cognitive impairment.

Measure: MMSE - Mini Mental State Examination

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

---

Primary Outcomes

Description: Mean methylation percentage in CpG island BDNF CpG exon I: located at chr11:27743473-27744564 in the BDNF

Measure: Change in methylation at Cytosine-phosphate-Guanine (CpG) exon

Time: Baseline and after 4 months

---

Description: Mean methylation percentage of CpG region BDNF CpG exon IV: located at chr11:27723060-27723294 in exon IV, upstream of the start codon in exon VII

Measure: Change in methylation at CpG exon IV

Time: Baseline and after 4 months

---

Secondary Outcomes

Description: Total score in Measurement and Treatment Research to Improve Cognition in Schizophrenia (MATRICS) Consensus Cognitive Battery

Measure: Change in cognition

Time: Baseline and after 4 months

---

Description: Total score in Positive and Negative Syndromes Scale (PANSS)

Measure: Change in Symptoms

Time: Baseline and after 4 months

---

Primary Outcomes

Description: The MADRS contains 10 items, and each item is scored 0-6. These item scores are summed to create a scale score; thus, scale scores range from 0 to 60. A scale score of 0 indicates the absence of depressive symptoms, while a score of 60 indicates severe depression. The primary outcome is the mean change in total MADRS score. A decrease in the mean MADRS score indicates a decrease (or improvement) in depressive symptoms, whereas an increase in the mean MADRS score indicates an increase (or worsening) in depressive symptoms.

Measure: Montgomery-Åsberg Depression Rating Scale (MADRS) Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Secondary Outcomes

Description: The CGI is a clinician-measured scale of 3 items: Severity of Illness (item 1), Global Improvement (item 2), and Efficacy Index (item 3). Items 1 and 2 are rated on a 7-point Likert scale (1=normal, 7=among the most extremely ill patients) with a possible response of "not assessed." Item 3 is rated on a 4-point Likert scale from "none" to "outweighs therapeutic effect." Items 1 and 3 are assessed in relation to last clinical encounter (if possible).

Measure: Clinical Global Impression/Severity (CGI) Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The GAD-7 is the self-reported anxiety questionnaire which scores each of the 7 symptoms of Generalized Anxiety Disorder in the last two weeks on a 4-point scale, i.e. 0 ("not at all"), 1 ("several days"), 2 ("over half the days") and 3 ("nearly every day"). Functional impairment is also assessed from "Not difficult at all" to "Extremely difficult."

Measure: Generalized Anxiety Disorder, 7-item (GAD-7) Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The MoCA is a 30-point screening instrument for detecting cognitive dysfunction. It is used to assess the following cognitive domains: visuospatial/executive, naming, memory, attention, language, abstraction, delayed (short-term memory recall), and orientation.

Measure: Montreal Cognitive Assessment (MoCA) Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The PHQ-9 is the self-reported depression module of the PHQ, which scores each of the 9 symptoms of a major depressive episode on a 4-point scale, i.e. 0 ("not at all"), 1 ("several days"), 2 ("more than half the days") and 3 ("nearly every day"). Functional impairment is also assessed from "Not difficult at all" to "Extremely difficult."

Measure: Patient Health Questionnaire, 9-item (PHQ-9) Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The TCI is a 240-item questionnaire. It operates with seven dimensions of personality traits, i.e. four so-called temperaments: Novelty Seeking (NS), Harm Avoidance (HA), Reward Dependence (RD), and Persistence (PS), and three so-called characters: Self-Directedness (SD), Cooperativeness (CO) and Self-Transcendence (ST). Each of these traits has a varying number of subscales.

Measure: Temperament and Character Inventory (TCI) Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Other Outcomes

Description: The patient will be asked to continuously wear a Fitbit wristband to monitor gross motor activity, e.g. foot steps. Changes in gross motor activity throughout the day will also provide data on circadian rhythmicity (sleep-wake cycles).

Measure: Actigraphy Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The investigators will obtain tissue samples, e.g. blood, saliva, and/or cheek swabs, and DNA will be isolated and extracted. Data on genetic polymorphisms (differences) that have been demonstrated or hypothesized to play a functional role in major depression, e.g. the brain derived neurotrophic factor (BDNF) rs6265 (val66met) single nucleotide polymorphism, will be obtained. These genotypes (genetic data) will then be correlated with antidepressant response.

Measure: Candidate Gene (DNA) Polymorphisms

Time: The genetic specimen will be obtained within approximately 1 week of starting treatment (likely with the baseline epigenetic sample.

---

Description: The investigators will obtain task-free ("resting state") rs-EEG [detecting electrical signals in the brain] at baseline and in response to interventional treatments for treatment-resistant depression.

Measure: Electroencephalography (EEG) Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The investigators will obtain tissue samples, e.g. blood, saliva, and/or cheek swabs, at baseline and in response to interventional treatments for treatment-resistant depression. DNA will be isolated and extracted. Data on epigenetic (experience-based) modifications to the DNA that have been demonstrated or hypothesized to play a functional role in major depression, e.g. global methylation changes, will be obtained. Changes in epigenetic status, e.g. global DNA methylation changes pre- and post-treatment, will then be correlated with antidepressant response.

Measure: Epigenetic (Experience-Based) DNA Modifications Pre-Post Change

Time: The initial specimen will be obtained within approximately 1 week of starting treatment. The post-specimen will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: Facial recognition software, FaceX (FaceX LLC) will be used to record and analysis facial features at rest and evoked by interview questions and emotionally provocative videos.

Measure: Facial Expression Analysis Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: Galvanic skin response as a surrogate marker of autonomic reactivity will be obtained in response to the presentation of emotional stories or images.

Measure: Galvanic Skin Response Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: Heart rate variability as a surrogate marker of autonomic reactivity will be obtained in response to the presentation of emotional stories or images.

Measure: Heart Rate Variability Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The NIH Toolbox is a comprehensive set of neurobehavioral assessments that assess multiple neuropsychiatric domains. We will perform the cognitive and emotional batteries in this study.

Measure: National Institutes of Health (NIH) Toolbox(R) Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: Pupillometry (pupil diameter measurements) as a surrogate marker of autonomic reactivity will be obtained in response to the presentation of emotional stories or images.

Measure: Pupillometry Pre-Post Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Post-assessment will be obtained as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The investigators will obtain task-free ("resting state") rs-fMRI [detecting blood oxygen-level dependent (BOLD) signal in the brain] at baseline and in response to interventional treatments for treatment-resistant depression.

Measure: Resting State Functional Magnetic Resonance Imaging (rs-fMRI) Pre-Post Change

Time: The initial imaging session will be obtained within approximately 1 week of starting treatment. The post-treatment imaging session occur as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The investigators will obtain structural brain imaging at baseline and in response to interventional treatments for treatment-resistant depression.

Measure: Structural Magnetic Resonance Imaging (MRI) Pre-Post Change

Time: The initial imaging session will be obtained within approximately 1 week of starting treatment. The post-treatment imaging session occur as close as possible following completion of treatment course (usually 4-6 weeks later).

---

Description: The patient will be asked to read standardized passages, i.e. Grandfather Passage and Rainbow Passage, and answer questions about daily life and interests while being recorded. These recordings will be transcribed and analyzed for vocal tone, inflection, word choice, etc.

Measure: Vocal Pattern Detection Pre, During and Post-Change

Time: Pre-assessment will be obtained within approximately 1 week of starting treatment. Interim assessments will occur weekly during treatment. Post-assessment will be obtained as close as possible following completion of treatment course.

---

Primary Outcomes

Description: Performances on the computerized cognitive test of Multi-Source Interference Task will be examined in terms of speed and accuracy. Participants are instructed to identify the target number, which is different than the other 3 numbers provided on the computer screen. There are two types of trials, congruent and incongruent. Congruent trials have a target number that is always matched its position on the button (e.g., 100, 020, or 223), in contrast, incongruent trials have the target number that is never matched with it position in the button (e.g., 010, 233, or 232). Faster response time and lower error rates indicate better attention.

Measure: Changes in attention - Multi-Source Interference Task

Time: Baseline, 4 weeks, 8 weeks, and 26 weeks

---

Description: Participants are instructed to remember the sequence of numbers the data collector told and repeat the numbers right after the instructor finished talking. This test has 2 subsets, Forward-repeat exactly the same sequence, and Backward-repeat the numbers in the backward from last to the first. More digits correctly repeated indicate better attention.

Measure: Changes in attention - Digit Span Test

Time: Baseline, 4 weeks, 8 weeks, and 26 weeks

---

Description: This traditional cognitive test of attention is a paper-pencil based measure and has 2 parts. Part A requires participants to connect a series of randomly arrayed, distinct circles numbered 1 to 25 in correct order as quickly as possible. Part B requires participants to connect a series of 25 circles numbered 1 to 13 randomly intermixed with letters from A to L, alternating between numbers and letters, and proceeding in ascending order (e.g., 1-A-2-B-3 and so on). Faster response time in seconds indicates better attention.

Measure: Changes in attention - Trail Making Test

Time: Baseline, 4 weeks, 8 weeks, and 26 weeks

---

Description: Stroop Test is a color-word test measuring the ability to processe different visual features and ignore distractions. The test has 2 parts of reading letters of color names and colors of color names using 4 color names (i.e., red, blue, yellow, and green). Congruent trials have the same letters and colors of the color names (i.e., red in red color). Incongruent trials have different letters and colors of the color names (i.e., red in blue color). Faster response time and lower error rates indicate better attention.

Measure: Changes in attention - Stroop Test

Time: Baseline, 4 weeks, 8 weeks, and 26 weeks

---

Description: This self-reported questionnaire has 13 items on 0 to 10 response scales asking effectiveness in behaviors requiring attention. Higher scores indicate better subjective attention

Measure: Changes in attention - Attentional Function Index

Time: Baseline, 4 weeks, 8 weeks, and 26 weeks

---

Secondary Outcomes

Description: This self-reported questionnaire consists of 29 items divided into 3 scales measuring self-care maintenance, symptom perception, and self-care management. In addition, self-care confidence is measured by additional 10 items. Each scale is scored separately and standardized to achieve a possible score of 0 to 100. Higher scores indicate better self-care of HF.

Measure: Changes in the Self-Care of Heart Failure Index (SCHFI)

Time: Baseline, 4 weeks, 8 weeks, and 26 weeks

---

Description: Minnesota Living with Heart Failure Questionnaire will be used to measure health-related quality of life. This self-report questionnaire consists of 21 items on which patients are asked to rate how their HF condition impacted their physical and emotional health. Lower scores indicate better HRQL.

Measure: Changes in Minnesota Living with Heart Failure Questionnaire (LHFQ)

Time: Baseline, 4 weeks, 8 weeks, and 26 weeks

---

Other Outcomes

Description: Venipuncture will be performed to draw the blood by following Indiana University general laboratory safety guidelines. Changes in the serum BDNF levels (ng/ml) and its associations with attention will be examined.

Measure: Changes in serum brain-derived neurotrophic factor levels (serum BDNF)

Time: Baseline and 4 weeks

---

Description: Venupucture will be performed to draw the blood for the possible genetic biomarker. The frequency of BDNF Val66Met genotype (e.g., rs6265) will be examined and attention will be examined by the genotype.

Measure: BDNF gene

Time: Baseline

---

Description: Venupucture will be performed to draw the blood for the possible genetic biomarker. The 3 common allele of APOE (i.e., e2, e3, and e4) will be examined. The frequency of APOE genotypes (e.g., rs7412, rs429358) will be examined and attention will be examined by the genotype.

Measure: Apolipoprotein (APOE) gene

Time: Baseline

---

Description: Venupucture will be performed to draw the blood for the possible genetic biomarker. Specifically, dopamine receptor gene 4 (e.g., 48 bp VNTR) polymorphism and its association with attention will be examined.

Measure: Dopamine receptor gene

Time: Baseline

---

Description: Venupucture will be performed to draw the blood for the possible genetic biomarker. The dopamine transporter gene (DAT1) (e.g., rs28363170 - 40 bp VNTR) polymorphism and its association with attention will be examined.

Measure: Dopamine transporter gene

Time: Baseline

---

Primary Outcomes

Description: The East Boston Memory Test is a performance-based neurocognitive test. Participants are read a brief story with 12 key elements. The participants are asked to recall elements immediately and again after three-minute delay. Each score (immediate and delayed recall) has a scale of 0-12, with a higher score indicating better cognitive performance.

Measure: Change in East Boston Memory Test scores from baseline to 24 weeks, 48 weeks, and 72 weeks

Time: Baseline, and 24 weeks, 48 weeks, and 72 weeks post-baseline

---

Description: The Category Fluency Test is a performance-based neurocognitive test. Participants are asked to generate examples for two semantic categories (animals, fruits/vegetables) in separate 60-second trials. There are two separate scores (number of animals generated, number of fruits/vegetables generated). A minimum possible score is 0, with an infinite possible maximum score, with a higher score indicating better cognitive performance.

Measure: Change in Category Fluency Test scores from baseline to 24 weeks, 48 weeks, and 72 weeks

Time: Baseline, and 24 weeks, 48 weeks, and 72 weeks post-baseline

---

Description: The Digit Span Forwards and Backwards Test is a performance-based neurocognitive test. The examiner says a string of numbers (digit span). For Digit Span Forwards, participant recites digit span, gradually increasing in length. Test stops when participant fails to recite digit span of same length twice. For Digit Span Backwards, participant recites digit span backwards. There are two separate scores (Digit Span Forwards correct responses, Digit Span Backwards correct responses). Digit Span Forwards scores can range from 0-16, with higher scores indicating higher cognitive performance. Digit Span Backwards Scores range from 0-14, with higher scores indicating higher cognitive performance.

Measure: Change in Digit Span Forwards and Backwards Test scores from baseline to 24 weeks, 48 weeks, and 72 weeks

Time: Baseline, and 24 weeks, 48 weeks, and 72 weeks post-baseline

---

Description: First, participants are asked to count from 1 to 25 (Part A). For Part B, the person is asked to verbally recite alternating numbers and letters until they reach 13 and the letter M. Possible minimum score is "discontinued" due to failure to complete the test (a zero score). The maximum score is 300 seconds. A lower score (fewer seconds) indicates higher cognitive performance.

Measure: Change in Oral Trails A/B tests scores from baseline to 24 weeks, 48 weeks, and 72 weeks

Time: Baseline, and 24 weeks, 48 weeks, and 72 weeks post-baseline

---

Description: Participants are asked to memorize and immediately recall in ascending order a series of numbers that gradually increase in length with each trial. Possible scores range from 0-16, with a higher score indicating higher cognitive performance.

Measure: Change in Digit Ordering Tests scores from baseline to 24 weeks, 48 weeks, and 72 weeks

Time: Baseline, and 24 weeks, 48 weeks, and 72 weeks post-baseline

---

Secondary Outcomes

Description: We will obtain blood samples for BDNF. Pretreatment serum or plasma specimens will be prepared using standard techniques and archived at -80°C in aliquots with no specimen subjected to more than two freeze-thaw cycles. All assays performed in a blinded fashion and according to manufacturer's protocol using a 384-well modified method. Luminex FlexMAP 3D will be used with concentrations calculated based on 7-pt standard curves using a 5-parametric fit algorithm in xPONENT v4.0.3. Following recommendations, serum biomarkers will be obtained in the morning (8am-10am) following an 8-hour fast.

Measure: Change in brain-derived neurotrophic factor (BDNF) levels from baseline to 24 weeks, 48 weeks, and 72 weeks

Time: Baseline, and 24 weeks, 48 weeks, and 72 weeks post-baseline

---

Description: We will obtain blood samples for VEGF. Pretreatment serum or plasma specimens will be prepared using standard techniques and archived at -80°C in aliquots with no specimen subjected to more than two freeze-thaw cycles. All assays performed in a blinded fashion and according to manufacturer's protocol using a 384-well modified method. Luminex FlexMAP 3D will be used with concentrations calculated based on 7-pt standard curves using a 5-parametric fit algorithm in xPONENT v4.0.3. Following recommendations, serum biomarkers will be obtained in the morning (8am-10am) following an 8-hour fast.

Measure: Change in vascular endothelial growth factor A (VEGF) levels from baseline to 24 weeks, 48 weeks, and 72 weeks

Time: Baseline, and 24 weeks, 48 weeks, and 72 weeks post-baseline

---

Description: We will obtain blood samples for IGF-1. Pretreatment serum or plasma specimens will be prepared using standard techniques and archived at -80°C in aliquots with no specimen subjected to more than two freeze-thaw cycles. All assays performed in a blinded fashion and according to manufacturer's protocol using a 384-well modified method. Luminex FlexMAP 3D will be used with concentrations calculated based on 7-pt standard curves using a 5-parametric fit algorithm in xPONENT v4.0.3. Following recommendations, serum biomarkers will be obtained in the morning (8am-10am) following an 8-hour fast.

Measure: Change in insulin-like growth factor 1 (IGF-1) from baseline to 24 weeks, 48 weeks, and 72 weeks

Time: Baseline, and 24 weeks, 48 weeks, and 72 weeks post-baseline

---

Description: The ActiGraph accelerometer is a motion sensor device that provides a valid assessment of physical activity in adult persons during treadmill Moveing/running and daily activity. The accelerometer records vertical accelerations as "counts." Participants are instructed to wear on the hip for seven consecutive days during waking hours only, except while swimming or bathing. To analyze the accelerometer data, we will use the following physical activity intensity cut points: light 100-1,565 counts/min (< 3 METS [metabolic equivalent of task]); moderate 1,566-6,139 (3.0-6.0 METS); vigorous ≥ 6,140 (≥ 6.1 METS). We will report findings in mean daily minutes of each intensity of physical activity.

Measure: Change in GT3XE-Plus Triaxial Accelerometer activity minutes (light and moderate vigorous physical activity) from baseline to 24 weeks, 48 weeks, and 72 weeks

Time: Baseline, and 24 weeks, 48 weeks, and 72 weeks post-baseline

---

Description: This is a test of aerobic fitness that can be performed in a small space using minimal equipment. Participants step in place to a predesignated height for two minutes. This test is correlated with treadmill tests of aerobic fitness.

Measure: Change in the two-minute step test of aerobic fitness score from baseline to 24 weeks, 48 weeks, and 72 weeks

Time: Baseline, and 24 weeks, 48 weeks, and 72 weeks post-baseline

---

Description: The Community Health Activities Model Program for Seniors (CHAMPS) is a 30-item self-report questionnaire that assesses the leisure time, household, and transportation physical activity in past two weeks. Participants are asked how long they participate in 30 different activities and at what frequency. Each activity is assigned intensity. Scores include mean minutes per week of light and moderate-vigorous physical activity for both leisure time and household scales (minimum score of 0 minutes and maximum score of 24 hours, with higher scores indicating more time spent in physical activity).

Measure: Change in self-reported physical activity as assessed by the Community Healthy Activities Model Program for Seniors (CHAMPS) survey from baseline to 24 weeks, 48 weeks, and 72 weeks

Time: Baseline, and 24 weeks, 48 weeks, and 72 weeks post-baseline

---

Description: Self-report cognitive activity is a self-report questionnaire of participation in seven activities that involve information processing with minimal physical or social demands. Participants rate on a five-point scale. The score is an average of nine items (minimum score of 9, maximum score of 54 with higher scores indicating higher self-reported levels of cognitive activity).

Measure: Change in self-reported cognitive activity from baseline to 24 weeks, 48 weeks, and 72 weeks

Time: Baseline, and 24 weeks, 48 weeks, and 72 weeks post-baseline

---

Other Outcomes

Description: Depressive symptoms will be evaluated as a potential moderator. The Center for Epidemiologic Studies-Depression Scale (20 items scored 0-3) assesses symptoms of depressed mood, feelings of guilt and worthlessness, feelings of helplessness and hopelessness, psychomotor retardation, loss of appetite, and sleep disturbance. Participants who score ≥ 16 will be referred to their primary/ psychiatric provider for further evaluation and treatment. Scores range from 0-60, with higher score indicating more depressive symptoms.

Measure: Level and change in Center for Epidemiologic Studies-Depression Scale score from baseline to 24 weeks, 48 weeks, and 72 weeks.

Time: Baseline, and 24 weeks, 48 weeks, and 72 weeks post-baseline

---

Description: Potential moderator. Candidate gene analysis with DNA extraction from whole blood samples using an Autogen DNA isolation kit (Qiagen, Venlo, Netherlands). Participants will be characterized by APOE genotype and subdivided into two groups of patients in whom the APOE ε4 allele was absent or present.

Measure: Apolipoprotein [APOE]- ε4 allele

Time: Baseline

---

Description: Potential moderator. Val66Met polymorphism in the BDNF gene assessed using candidate genotyping. The BDNF gene locus is located on Chromosome 11. BDNF Met positive genotypes are heterozygous Val/Met or homozygous Met/Met.

Measure: Brain-derived neurotrophic factor (BDNF) Val66Met polymorphism

Time: Baseline

---

Primary Outcomes

Description: Picture Sequence Memory Test. Test-retest reliability of the test is 0.77. Convergent validity and discriminant validity is 0.69 and -0.08, respectively.

Measure: Episodic memory

Time: Three months

---

Description: Dimensional Change Card Sort Test. Test-retest reliability of the test is 0.88. Convergent validity and discriminant validity is -0.51 and 0.14, respectively.

Measure: Executive function

Time: Three months

---

Description: List Sorting Working Memory Test. Test-retest reliability of the test is 0.77. Convergent validity and discriminant validity are 0.58 and 0.30, respectively.

Measure: Working memory

Time: Three months

---

Description: Pattern Comparison Processing Speed Test. The test takes about 3 minutes to compete. Test-retest reliability of the test is 0.72. Convergent validity and discriminant validity is 0.49 and 0.12, respectively.

Measure: Processing speed

Time: Three months

---

Secondary Outcomes

Measure: Plasma BDNF in ng/mL

Time: Three months

---

Measure: Fasting blood glucose in mg/dL

Time: Three months

---

Measure: HbA1c in percentage

Time: Three months

---

Measure: Weight in kilograms

Time: Three months

---

Measure: Height in meters

Time: Three months

---

Description: weight and height will be combined to report BMI in kg/m^2

Measure: BMI

Time: Three months

---

Primary Outcomes

Measure: BDNF DNA demethylation in percentage

Time: Three months

---

Secondary Outcomes

Measure: Plasma BDNF levels in ng

Time: Three months

---

Description: Executive function will be measured by the Dimensional Change Card Sort Test. Test-retest reliability of the test is 0.88. Convergent validity and discriminant validity is -0.51 and 0.14, respectively.

Measure: Executive function

Time: Three months

---

Description: Episodic memory will be measured by the Picture Sequence Memory Test. Test-retest reliability of the test is 0.77. Convergent validity and discriminant validity is 0.69 and -0.08, respectively.

Measure: Episodic memory

Time: Three months

---

Description: Working memory will be measured by the List Sorting Working Memory Test. Test-retest reliability of the test is 0.77. Convergent validity and discriminant validity are 0.58 and 0.30, respectively.

Measure: Working memory

Time: Three months

---

Description: Processing speed will be measured by the Pattern Comparison Processing Speed Test. The test takes about 3 minutes to compete. Test-retest reliability of the test is 0.72. Convergent validity and discriminant validity is 0.49 and 0.12, respectively.

Measure: Processing speed

Time: Three months

---